جداسازی و شناسایی باکتری‌های لاکتیکی از محصولات لبنی سنتی کلیبر، هریس و ورزقان

نوع مقاله: علمی پژوهشی

نویسندگان

1 دانشگاه شهید مدنی آذربایجان، دانشکده کشاورزی، دانش‌آموخته کارشناسی ارشد گروه بیوتکنولوژی، تبریز، ایران.

2 دانشگاه شهید مدنی آذربایجان، دانشکده کشاورزی، دانشیار گروه بیوتکنولوژی، تبریز، ایران.

3 فوق دکتری، استادیار، پژوهشکده بیوتکنولوژی کشاورزی شمالغرب و غرب کشور، تبریز، ایران.

چکیده

   پروبیوتیک­ها مکمل­های غذایی از میکروارگانیسم­های زنده­ای هستند که با قرار گرفتن در محیط روده می­توانند تعادل میکروبی را در جهت افزایش سودمندی آن­ها اصلاح کنند و با فعالیت خود مانع از فعالیت میکروارگانیسم­های غیر مفید و بیماری‌زا شوند. از میان باکتری­ها، باکتری­های اسیدلاکتیک، متداول­ترین نوع باکتری­هایی هستند که به عنوان پروبیوتیک معرفی شده­اند. این باکتری­ها در محصولات لبنی وجود داشته و در طول مراحل تخمیر، اسید لاکتیک تولید می­کنند. هدف از این تحقیق، جداسازی و شناسایی باکتری‌های پروبیوتیک از فلور موجود در شیر، ماست و دوغ سنتی مناطق کلیبر، هریس و ورزقان می­باشد. جهت انجام این مطالعه، باکتری­های لاکتیکی توسط روش­های متداول کشت و شناسایی بر اساس خواص بیوشیمیایی شناسایی شدند و مقاومت به اسید معده و نمک­های صفراوی مورد ارزیابی قرار گرفت. سپس برای شناسایی دقیق­تر با جفت آغازگرهای اختصاصی، ژن 16SrRNA باکتری­ها تکثیر داده شد و بعد از خالص­سازی محصول PCR، ژن مورد نظر تعیین توالی گردید. در نتیجه این بررسی، 17 سویه لاکتوباسیلوس و 6 سویه انتروکوکوس از مناطق کلیبر، هریس و ورزقان جدا شده­اند که می­توانند کاندید مناسبی برای بررسی­های بیشتر به عنوان پروبیوتیک باشند. 

کلیدواژه‌ها


عنوان مقاله [English]

Isolation and identification of lactic acid bacteria from traditional dairy products of Kleibar, Heris and Varzaghan

نویسندگان [English]

  • T Narimani 1
  • A Tarinejad 2
  • M.A Hejazi 3
1 MSc Student, Department of Biotechnology, Faculty of Agriculture, Azarbaijan Shahid Madani University, Tabriz, Iran
2 - Associate Professor, Department of Biotechnology, Faculty of Agriculture, Azarbaijan Shahid Madani University, Tabriz, Iran.
3 - Agricultural Biotechnology Research Institute of Iran, Branch of North-West and West region, Tabriz, Iran.
چکیده [English]

Probiotics are dietary supplements of live microorganisms which when consumed in adequate amounts, can have a beneficial effect on the host. Among all bacteria, lactic acid bacteria are the most common type that has been introduced as probiotics. These bacteria are present in dairy products and produce lactic acid during the fermentation process. The aim of this study was to isolate and identify the probiotics from microbial flora of milk and traditional yogurt in Kaleibar, Heris and Varzaghan areas. In this study, lactic acid bacteria were isolated by culture and identified based on biochemical properties and resistant to stomach acid and bile salts were evaluated. Then, for more accurate identification of the isolates, the 16S rRNA genes of Lactobacilli were amplified with specific primers and the purified PCR product was sent for sequencing. According to our results, 17 strains of Lactobacilli and 6 strains of Enterococci were reported in Kaleibar, Heris and Varzaghan areas which could be a good candidate for further investigation as probiotic.

کلیدواژه‌ها [English]

  • Enterococci
  • Probiotic Bacteria
  • 16S rRNA gene
  • Lactobacilli

مقدمه

    مفهوم امروزی پروبیوتیک عبارت است از اجرام زنده­ای که با قرار گرفتن در محیط روده می­توانند تعادل میکروبی را در جهت افزایش سودمندی آن­ها اصلاح کنند و با فعالیت خود مانع از فعالیت میکروارگانیسم‌های غیرمفید و بیماری‌زا شوند (Klaenhammer, 2000). اخیراً آزمون­های بالینی اثرات مفید باکتری­های پروبیوتیک از قبیل پیشگیری از اسهال، متعادل کردن میکروفلور روده، تحریک سیستم ایمنی، تعدیل هموستازی ایمنی سیستمیک، خصوصیات ضد توموری و اصلاح عدم تحمل لاکتوز را نشان داده­اند. همچنین محققان نشان داده­اند که باکتری‌های پروبیوتیک با تولید باکتریوسین­ها و اسیدهای آلی، رشد پاتوژن­ها را مهار می­کنند Schrezenmeir and Vrese, 2001)). شواهد نشان می­دهند که میکروارگانیسم­های معینی به ویژه ارگانیسم­های تولیدکننده اسید لاکتیک که ساکنان طبیعی مجرای معده­ای­- روده­ای هستند، به بازسازی تعادل میکرواکولوژیکی روده کمک می­کنند. بهینه‌سازی میکروبیوتای همزیست با دستگاه گوارشی به وسیله سویه­های اختصاصی از میکروبیوتای روده سالم، اساس درمان پروبیوتیکی را تشکیل می­دهد (Saarela et al., 2002). از میان میکروارگانیسم­های پروبیوتیک، باکتری‌های اسید لاکتیک به عنوان مهم­ترین گروه شناخته شده­اند که در این میان دو جنس لاکتوباسیلوس و انتروکوکوس جزء فلور طبیعی دستگاه گوارش و غذاهای تخمیر شده محسوب می‌شوند (Klaenhammer, 2000). جنس لاکتوباسیلوس اولین­بار توسط بیرجینگ Birjing توصیف شده است که شامل 60 گونه و زیرگونه می‌باشد (Ayele et al., 2001). لاکتوباسیلوس­ها­ به دلیل توانایی­شان در تخمیر و نیز اهمیت­شان در سلامتی انسان به عنوان پروبیوتیک­ها مورد توجه زیادی قرار گرفته­اند. آن­ها ترکیباتی مانند اسیدهای آلی، دی استیل، پراکسید هیدروژن و نیز باکتریوسین­ها را در طی تخمیر لاکتیک تولید می­کنند که اثر حفاظتی آنها در مواد غذایی از اهمیت ویژه­ای برخوردارند (میردامادی و تنگستانی، 1390). انتروکوک‌ها به وسیله تیرسلینThiercelin  توصیف شدند و توزیع وسیع آن­ها در طبیعت احتمالاٌ بوسیله ماندگاری و مقاومت به فاکتورهای بازدارنده رشد توضیح داده می­شوند (Holzapfel et al., 2002). تحمل اسیدیته بالا و مقاومت به نمک­های صفراوی از جمله خصوصیات اولیه و ضروری است که در این تحقیق برای غربالگری سویه­های با پتانسیل پروبیوتیکی در نظر گرفته شده است (Durme et al., 2001). برای شناسایی دقیق­تر پروبیوتیک­ها، علاوه بر شناسایی بیوشیمیایی، استفاده از ژن 16S rRNA و توالی‌یابی در شناسایی مولکولی توسط واکنش PCR انجام شده است (Cakir, 2003). در ایران مطالعاتی در زمینه جداسازی و شناسایی باکتری­‌های پروبیوتیک صورت گرفته است. ابراهیمی و همکاران (2011) از محصولات لبنی سنتی ماست و پنیر موفق به جداسازی و شناسایی لاکتوباسیلوس پلانتاروم، لاکتوباسیلوس کازئی و لاکتوباسیلوس برویس شدند. تاج­آبادی و همکاران (2011)، 42 ایزوله لاکتوباسیلوس از محصول سنتی ترخینه و دوغ آن، جداسازی و  خواص پروبیوتیکی آن‌ها را بررسی نموده و چهار ایزوله با بالاترین درصد مهار رشد باکتری­های بیماری‌زا را به دست آوردند (Tajabady et al., 2011). بنابراین جداسازی، شناسایی و کاربرد باکتری­های پروبیوتیک از محصولات لبنی سنتی می­تواند راهکاری مناسب در جهت ارائه محصولات پروبیوتیک سنتی ایران و سویه­های پروبیوتیک بومی با خصوصیات عملکردی ویژه باشد.

 

مواد و روش­ها

نمونه­برداری

   نمونه­های شیر، ماست و دوغ سنتی از شهرستان‌های کلیبر، هریس و ورزقان جمع­آوری و در فالکون‌های استریل و در مجاورت بسته­های یخی به آزمایشگاه منتقل گردیدند و تا شروع آزمایش در دمای یخچال نگه‌داری شدند.

تهیه تعلیق باکتریایی و کشت اولیه

   تهیه تعلیق باکتریایی از نمونه­های شیر و ماست و دوغ با استفاده از محلول پپتون فیزیولوژیکی استریل (5/8 گرم بر لیتر کلرید سدیم و 1 گرم بر لیتر پپتون باکتریولوژیکی) انجام شد. ابتدا حدود 10 گرم از نمونه‌های ماست با استفاده از یک قاشقک استریل و 10 میلی‌لیتر از نمونه­های شیر و دوغ هر کدام به صورت جداگانه به 100 میلی­لیتر PPS (Physiological Peptone Solution) استریل منتقل گردید. پس از یکنواخت نمودن به وسیله تکان دادن به مدت نیم ساعت 10 میلی­لیتر از تعلیق­های تهیه شده به صورت جداگانه، به 200 میلی­لیتر از محیط کشت MRS (Man, Rogosa & Sharp) مایع (شرکت سیگما‌ - آلدریچ آمریکا) انتقال یافت تا باکتری­ها به حداکثر مقدار خود برسند و در شرایط کم هوازی (شرایط اتمسفری با فشار اکسیژن پائین) و در دمای 37 درجه به مدت 24 ساعت انکوبه (شرکت Binder آلمان، مدل B34) گردید. تمامی این مراحل در زیر هود لامینار و شرایط استریل انجام شد (Calicchia et al., 1993).

غربال جمعیت باکتریایی اولیه و انتخاب ایزوله­‌های مقاوم به اسید

    در این مرحله بعد از کشت 24 ساعته از نمونه­های شیر و ماست و دوغ در دمای 37 درجه سلسیوس، 10 میلی­لیتر از کشت­های باکتریایی به بافر PBS (Phosphate Buffered Saline) با 3 pH=تلقیح شدند. سپس به مدت 5/2 ساعت در 37 درجه انکوبه شدند. باکتری­های زنده مانده (باکتری­های مقاوم به اسید) در شرایط اسیدی با استفاده از سانتریفیوژ (شرکت Heraeus آلمان، مدل megafuge1.0) ترسیب و به محیط کشت MRS مایع، به منظور غنی­سازی انتقال یافتند و به مدت 24 ساعت و در دمای 37 درجة سلسیوس انکوبه شدند. بعد از 24 ساعت، سلول­ها با استفاده از سرم فیزیولوژیکی استریل (کلرید سدیم: 5/8 گرم بر لیتر) تا ده برابر رقیق شدند و از هر رقت یک میلی­لیتر و به صورت کشت آمیخته در محیط کشت MRS آگار (شرکت سیگما - آلدریچ آمریکا) کشت داده شدند. پلیت­ها در شرایط کم هوازی و در دمای 37 درجة سلسیوس به مدت 48-72 ساعت انکوبه گردیدند. از پلیت­های دارای پرگنه­های قابل شمارش، حدود 10 درصد از پرگنه­ها با مورفولوژی متفاوت جداسازی و روی محیط کشت MRS آگار خالص­سازی شدند. سپس همه سویه­ها با استفاده از میکروسکوپ، رنگ‌آمیزی گرم و واکنش کاتالاز بررسی شدند. باکتری‌های گرم مثبت و کاتالاز منفی در محیط کشت MRS مایع با 25% گلیسرول استریل و 25%  شیر پس چرخ (شرکت Merck آلمان) در دمای 80- درجة سلسیوس نگه‌داری شدند (Erkkila et al., 2000).

آزمایش­های میکروبی

تعیین درصد بقای ایزوله­ها در شرایط اسیدی معادل با شرایط اسیدی معده

    ایزوله­های جدا شده، در محیط MRS مایع و در دمای 37 درجه سلسیوس به مدت 24 ساعت رشد داده شدند. یک میلی­لیتر از هر کشت باکتریایی در 9 میلی­لیتر PBS با pH برابر با 5/2 تلقیح شدند و نمونه­ها به مدت 3 ساعت در 37 درجه سلسیوس انکوبه گردیدند. برای تعیین درصد بقاء، CFU (Colony Forming Unit) در لحظه تلقیح و در انتهای انکوباسیون 3 ساعته در PBS ، برای هر ایزوله به صورت جداگانه با استفاده از کشت رقت­های سریالی در محیط آگار MRS تعیین گردید.

تعیین مقاومت ایزوله­ها به نمک­های صفراوی

    محیط کشت MRS مایع به عنوان کنترل و MRS مایع دارای 3/0 درصد املاح صفراوی (شرکت Merck آلمان) به عنوان کشت مورد آزمایش (تیمار) به طور همزمان با یک  درصد از کشت باکتریایی فعال 24 ساعته تلقیح شد و در دمای 37 درجه سلسیوس به مدت 7 ساعت انکوبه شدند. منحنی­های رشد بر اساس جذب نوری برای هر ایزوله رسم و بر اساس اختلاف در جذب­های نوری متوالی بین کشت­های کنترل و تیمار به عنوان تأخیر در رشد در نتیجة اثر بازدارندگی نمک­های صفراوی در نظر گرفته شد (et al., 1984 Gilliland).

آزمایشات بیوشیمیایی

    شناسایی مورفولوژیکی ایزوله­ها با استفاده از تست کاتالاز، رنگ­آمیزی گرم، رشد در دماهای 10، 15 و 45 درجه سلسیوس و رشد در غلظت‌های مختلف نمک (5/6 و 4 درصد حجمی- وزنی کلرید سدیم در محیط کشت MRS مایع) انجام شد (Wood and Holzapfel, 1995; Garrity et al., 2004).

 

تعیین الگوی تخمیر کربوهیدرات­ها

     الگوهای تخمیر کربوهیدرات­ها (شرکت Merck آلمان)، (شامل آرابینوز، اینوزیتول، ترهالوز، رافینوز، رامنوز، ریبوز، زایلوز، ساکارز، سلوبیوز، فروکتوز، گالاکتوز، گلوکز، لاکتوز، مانوز، مانیتول، ملوبیوز، ملوزیتوز)، برای همه ایزوله­ها در محیط کشت MRS مایع دارای معرف فنل قرمز  به میزان 5/0 گرم بر لیتر تعیین گردید. محیط کشت پایه برای انجام واکنش از اجزای اصلی و با حذف گلوگز و عصارة گوشت و با افزودن فنل قرمز تهیه گردید. همة قندها به صورت محلول استوک 5% تهیه و بوسیلة یک فیلتر غشایی 2/0 میکرومتر استریل گردید. سپس 5/0 میلی‌لیتر از محلول قندهای استریل به 5/4 میلی‌لیتر محیط کشت پایه افزوده شد. نمونه­های جدا شده در دمای 37 درجه سلسیوس و به مدت 24 ساعت در محیط مایع MRS کشت داده شدند و 50 میکرولیتر از کشت فعال به محیط دارای قندهای اختصاصی تلقیح و به منظور مشاهدة واکنش‌های تأخیری به مدت 5 الی 7 روز در دمای ایزولاسیون (37 درجه سلسیوس) انکوبه گردیدند. در پایان مدت انکوباسیون، نتایج بر اساس تغییر رنگ معرف فنل از قرمز به زرد ارزیابی گردید (Harrigan and Mc Cance, 1976).

آزمایشات مولکولی

استخراجDNA

    استخراج DNA با استفاده از روش CTAB انجام شد. ترکیبات لیز بافر (شرکت Merck آلمان) شامل تریس 1 مولار با 5/7 pH=، کلرید سدیم 5 مولار، EDTA  5/0 مولار و SDS 2 درصد و آب مقطر می‌باشد. برای بررسی کیفیت DNA استخراج شده از ژل آگارز 8/0 درصد در الکتروفورز به کار گرفته شد.

انجام واکنش زنجیره­ای پلیمراز و تکثیر قطعه ژن 16S rRNA (16S ribosomal RNA)

   پرایمرهای اختصاصی (شرکت سیناژن) برای تکثیر قطعه 16S rRNA برای ایزوله­های لاکتوباسیلوس با استفاده از نرم­افزار Oligo5 و با کمک توالی­های 16S rRNA موجود در سایت بانک ژنی NCBI (National Center for Biotechnology Information) طراحی گردید و واکنش PCR با پرایمرهای (5'AGAGTTTGATCCTGGCTCAG3') LF  و (5'AAGGTTACCTCACCGACTTC3')LR اختصاصی ایزوله­های لاکتوباسیلوس انجام شد. واکنش زنجیره­ای پلیمراز با چرخه­های واسرشته­
سازی اولیه در 95 درجه سلسیوس به مدت 4 دقیقه، 30 چرخه با مرحله واسرشته­سازی در 94 درجه سلسیوس به مدت 1 دقیقه، مرحله اتصال پرایمر در 57 درجه سلسیوس به مدت 1 دقیقه و بسط در 72 درجه سلسیوس به مدت 2 دقیقه و سرانجام یک چرخه بسط نهایی در 72 درجه سلسیوس به مدت 10 دقیقه انجام شد. واکنش PCR (Polymerase Chain Reactoin) با (µl 5/12) Master mix (شرکت سیناژن)، پرایمر رفت و برگشت هر کدام (µM 4/0) و (ng/µl 50) DNA و رساندن حجم نهایی واکنش با آب مقطر استریل به حجم 25 میکرولیتر انجام شد.

تفکیک قطعات تکثیر یافته

    برای تفکیک قطعات تکثیر یافته از ژل آگارز 5/1 درصد استفاده شد. بدین ترتیب که نمونه­های تکثیر یافته به نسبت 6 به 1 با بافر بارگذاری مخلوط و در چاهک­های ژل بارگذاری شدند. پس از اتمام الکتروفورز (شرکت VWR Scientific، مدل VWR105) به مدت یک ساعت با ولتاژ 100، ژل مورد نظر توسط اتیدیوم بروماید رنگ­آمیزی و با استفاده از نور UV مشاهده و عکس­برداری (شرکت Biometra آلمان، مدل BioDocAnalyze) انجام گرفت.

خالص­سازی محصول PCR

   با توجه به دستورالعمل کیت خالص­سازی (شرکت سیگما- آلدریچ آمریکا) از ژل آگارز، محصول PCR تخلیص گردید.

ارسال جهت توالی­یابی

   محصول خالص­سازی شده PCR، در تیوپ‌های 5/1 میلی­لیتری در حجم­های 50 میکرولیتر به همراه دو پرایمر رفت و برگشت (با غلظت­های 50 پیکومول بر میکرولیتر) در حجم­های 50 میکرولیتر، برای توالی­یابی به شرکت ماکروژن کره جنوبی ارسال شدند.

نرم­افزارآماری و بیوانفورماتیکی

    نتایج بدست آمده با استفاده ازنرم­افزار آماریSPSS 13 برای لاکتوباسیلوس­ها و انتروکوکوس­
ها مورد تجزیه قرار گرفته و گروه­بندی گردید. هم ردیف کردن مربوط به توالی­یابی ژن 16SrRNA ایزوله­ها با استفاده از برنامه بیوانفورماتیکی BLAST (Basic Local Alignment Search Tool) در  NCBI صورت گرفت.

 

یافته‌ها

   از 4 محصول شیر و ماست و دوغ مناطق کلیبر، ورزقان و هریس، در کل 23 ایزوله باکتری با پتانسیل پروبیوتیک جداسازی گردید که شامل 17 ایزوله لاکتوباسیلوس و 6 ایزوله انتروکوکوس می­باشد. تفکیک ایزوله­ها و نامگذاری آن­ها در جدول 1 آورده شده است.

 

 

جدول 1-  ایزوله­های جداسازی شده از محصولات لبنی سنتی

ایزوله­های انتروکوکوس

ایزوله­های لاکتوباسیلوس

نمونه لبنی

 

 

 

 

 

 

 

-

 

 

LA1, LA2, LA3, LA4, LA5, LA6, LA7

شیر کلیبر

 

EB1, EB2, EB3

 

 

LB1, LB2, LB3, LB4

 

ماست کلیبر

 

ED1, ED2, ED3

 

 

LD1, LD2, LD3

 

ماست ورزقان

 

-

 

LC1, LC2, LC3

 

دوغ هریس

6

17

کل نمونه­ها

*E نشان دهنده ایزوله­های انتروکوکوس و L نشان دهنده ایزوله­های لاکتوباسیلوس می­باشد.

 

   تعیین تحمل به اسیدیته برای تمام 23 ایزوله، در بافر  PBS باpH   برابر با 5/2 به طول سه ساعت در 37

درجه سلسیوس انجام شد که نتایج در جدول 2 گزارش شده است.

 

 

 

 

جدول 2- تعیین درصد بقای ایزوله­ها در 5/2=pH به مدت 3 ساعت

کمتراز 10%

بین60% و 10%

بین 80 % و 60%

بیشتراز80 %

درصد بقاء محصولات

-

LA7, LA5

LA1, LA2, LA3, LA4

LA6

شیر گاو کلیبر

-

LB1, EB1, EB2, EB3

LB2, LB3

LB4

ماست گاو کلیبر

ED2

LD3

LD1, LD2, ED1, ED3

-

ماست ورزقان

­­­­­­­­­­­­­­-

-

LC2, LC3

LC1

دوغ هریس

 

 

   

 

    بر اساس درصد بقاء، ایزوله­ها به 4 گروه حساس، مقاومت متوسط، مقاومت خوب و مقاومت بسیار خوب تقسیم شدند. بر اساس این نتایج، ایزوله ED2 کمترین مقاومت و 4 ایزوله باسیلی شکل و 3 ایزوله کوکسی شکل مقاومت متوسط و 10 ایزوله باسیلی شکل و 2 ایزوله کوکسی شکل مقاومت خوب و ایزوله­های LA6، LB4 و LC1 مقاومت بسیار خوبی را دارا بودند.

    بر اساس اختلاف در مدت زمان مورد نیاز برای اینکه میزان جذب نوری بین محیط کشت شاهد (MRS) و محیط کشت تیمار (MRS+ bill) به 3/0 واحد برسد، تحمل به نمک­های صفراوی محاسبه گردید. ایجاد تأخیر در رشد ایزوله­ها با نمک­های صفراوی، در نتایج بر اساس پیشنهاد ارائه شده توسط چاتیو و همکاران (1994)، که چهار گروه متمایز را بر اساس تأخیر رشد ایجاد شده به وسیله­ی نمک‌های صفراوی تشخیص داده بودند (Chateau et al., 1994)، تحلیل گردیدند:

1- ایزوله­های مقاوم (دارای تأخیر رشدی مساوی یا کمتر از 15 دقیقه)

2- ایزوله­هایی با تحمل بالا (تأخیر رشدی بین 15 و 45 دقیقه)

3- ایزوله­هایی با تحمل ضعیف (دارای تأخیر رشدی بین 40 و 60 دقیقه)

4- ایزوله­های حساس (تأخیر رشدی بیشتر از 60 دقیقه)

23 ایزوله منتخب، بر اساس تأخیر رشد گروه­بندی شدند که نتایج در جدول 3 آورده شده است.

 

 

جدول 3-  تعیین مقاومت به نمک­های صفراوی

تأخیر رشد برحسب دقیقه

d£15

15£d£40

40£d£60

d³60

ایزوله­ها

مقاوم

تحمل بالا

ضعیف

حساس

LA3, LB4, LB1

 

 

 

+

     

LA1, LA2, LA4, LA6, LB2, LB3, EB2, EB3, LD1, LD3 LC3, LC1

 

 

 

+

 

   

LA5, EB1, LD2, ED1, ED3, ED2, LC2,

   

 

+

 

LA7

     

+

* علامت + نشان‌دهنده اعضای گروه است.

*A (شیر گاو کلیبر)، B (ماست گاو کلیبر)، C (دوغ هریس)، D (ماست ورزقان)

 

 

   بعد از انتخاب باکتری­های مقاوم به اسید و تعیین میزان تحمل آن­ها به شرایط اسیدی و نمک­های صفراوی، شناسایی مقدماتی آن­ها با استفاده از تست­های بیوشیمیایی انجام شد. با توجه به مشخصات فنوتیپی، بیوشیمیایی و الگوی تخمیر قندی ایزوله­های لاکتوباسیلوس و انتروکوکوس (جدول4) و رسم دندروگرام مربوطه، لاکتوباسیلوس­ها با ضریب تشابه 14 درصد در پنج گروه و انتروکوکوس­ها با ضریب تشابه 15 درصد در سه گروه، قرار گرفتند. شکل 1 دندروگرام حاصل را برای ایزوله­های لاکتوباسیلوس و شکل 2 دندروگرام ایزوله­های انتروکوکوس را بر اساس نتایج تست­های بیوشیمیایی نشان می­دهد.

 

 

 

 

 

 

 

 

 

 

جدول4- مشخصات فیزیولوژیکی و بیوشیمیایی سویه­های لاکتوباسیلوس و انتروکوکوس استاندارد و سویه­های جدا شده با پتانسیل پروبیوتیکی

ملوزیتوز

ملوبیوز

مانیتول

مانوز

لاکتوز

گلوکز

گالاکتوز

فروکتوز

سلوبیوز

ساکارز

زایلوز

ریبوز

رامنوز

رافینوز

ترهالوز

اینوزیتول

آرابینوز

رشد در نمک 5/6%

رشد در نمک 4%

رشد در C0 45

رشد در C0 15

رشد در C0 10

کاتالاز

گرم

سویه ها

-

+

-

-

+

+

+

+

-

+

+

+

-

+

-

-

+

-

+

-

+

-

-

+

لاکتوباسیلوس

برویس

 

پلانتروم

+

+

+

+

+

+

+

+

+

+

+

+

-

+

+

-

+

-

+

-

+

-

-

+

لاکتوباسیلوس پلانتاروم

-

-

-

+

-

+

+

+

+

+

-

+

-

-

+

-

+

-

+

-

+

-

-

+

لاکتوباسیلوس

دایورجنس

-

+

-

+

+

+

+

+

+

+

+

+

-

+

+

-

+

-

+

-

+

-

-

+

لاکتوباسیلوس فرمنتوم

-

-

-

+

-

+

+

+

+

+

+

+

-

-

-

-

-

-

+

-

+

-

-

+

لاکتوباسیلوس کونفیوسوس

-

-

-

-

-

+

+

-

+

-

+

+

-

-

-

-

+

-

+

-

+

-

-

+

لاکتوباسیلوس واسینوسترکوس

-

-

-

+

+

+

+

+

+

-

-

+

-

-

+

-

-

+

+

+

+

+

-

+

انتروکوکوس دورانس

-

+

+

+

+

+

+

+

+

+

+

+

+

+

+

-

+

+

+

+

+

+

-

+

انتروکوکوس موندتی

-

-

+

-

_

+

-

+

+

-

+

+

-

-

-

-

+

-

+

-

+

-

-

+

LA1

-

-

+

-

-

+

-

+

-

-

+

+

-

-

-

-

+

-

+

+

+

-

-

+

LA2

-

-

-

+

-

+

+

+

+

+

+

+

-

-

-

-

-

-

+

+

+

-

-

+

LA3

-

-

-

-

-

+

+

+

-

-

+

+

-

-

-

-

+

-

+

-

+

-

-

+

LA4

-

-

-

+

-

+

+

+

+

-

-

+

-

-

+

-

+

-

+

+

+

-

-

+

LA5

 

ادامه جدول 4

ملوزیتوز

ملوبیوز

مانیتول

مانوز

لاکتوز

گلوکز

گالاکتوز

فروکتوز

سلوبیوز

ساکارز

زایلوز

ریبوز

رامنوز

رافینوز

ترهالوز

اینوزیتول

آرابینوز

رشد در نمک 5/6%

رشد در نمک 4%

رشد در C0 45

رشد در C0 15

رشد در C0 10

کاتالاز

گرم

سویه ها

-

-

-

+

+

+

-

+

-

-

+

+

-

-

+

-

+

-

+

+

+

-

-

+

LA6

-

-

-

+

+

+

+

+

+

-

-

+

+

-

+

-

-

-

+

-

+

-

-

+

LA7

+

-

-

+

-

+

+

+

+

-

+

+

+

-

+

-

+

-

+

-

+

-

-

+

LB1

-

-

-

+

-

+

+

+

+

-

+

+

-

-

+

-

+

-

+

-

+

-

-

+

LB2

_

-

-

+

-

+

+

+

+

-

+

+

-

-

+

-

+

-

+

-

+

-

-

+

LB3

-

+

+

+

+

+

+

+

+

+

+

+

-

+

+

-

-

-

+

-

+

-

-

+

LB4

+

+

+

+

+

+

+

+

+

+

+

+

-

+

+

-

+

-

+

-

+

-

-

+

LC1

-

+

-

-

+

+

-

+

+

+

+

+

-

+

-

-

+

-

+

-

+

-

-

+

LC2

+

+

-

-

+

+

-

+

+

+

+

+

-

+

-

-

+

-

+

-

+

-

-

+

LC3

-

-

-

+

+

+

+

+

+

-

-

+

-

-

+

-

-

-

+

-

+

-

-

+

LD1

-

-

-

+

+

+

+

+

+

+

-

+

-

-

+

-

-

-

+

-

+

-

-

+

LD2

-

-

-

+

+

+

+

+

+

-

-

+

-

-

+

-

-

-

+

-

+

-

-

+

LD3

-

+

+

+

+

+

+

+

+

+

+

+

+

+

+

-

+

+

+

+

+

+

-

+

EB1

-

+

+

+

+

+

+

+

+

+

+

+

+

+

+

-

+

-

+

-

+

+

-

+

EB2

+

-

-

+

+

+

+

+

+

-

+

+

+

-

+

-

+

-

+

-

+

+

-

+

EB3

-

-

-

+

+

+

+

+

+

-

-

+

-

-

+

-

-

+

+

+

+

+

-

+

ED1

-

-

-

+

+

+

+

+

+

-

+

+

+

-

+

-

+

+

+

+

+

+

-

+

ED2

-

-

-

+

+

+

+

+

+

-

-

+

-

-

+

-

-

+

+

+

+

+

-

+

ED3

 

 

 

 

 

 

 

 

 

شکل1- دندروگرام مربوط به ایزوله­های لاکتوباسیلوس

 

                                                            شکل2- دندروگرام مربوط به ایزوله­های انتروکوکوس

 

 

   با رسم دندروگرام، ایزوله­های لاکتوباسیلوس با ضریب تشابه 14 درصد به پنج گروه A, B, C, D و E تقسیم‌بندی شدند. گروه A الگوی رشدی و الگوی تخمیر کربوهیدراتی نزدیکی با لاکتوباسیلوس پلانتاروم و لاکتوباسیاوس فرمنتوم و لاکتوباسیلوس برویس  نشان دادند.LC1 مشابه لاکتوباسیلوس پلانتاروم و ایزوله LB3 الگوی کاملاً مشابه با لاکتوباسیلوس فرمنتوم را نشان دادند. در این گروه دو ایزوله LC2 و LC3 شبیه هم و با ضریب تشابه 7 درصد از لاکتوباسیلوس برویس جدا شدند. در گروه B دو ایزولهLB1  و LB2 الگوی نزدیکی با لاکتوباسیلوس واسینوسترکوس نشان دادند. چهار ایزوله در گروه C قرار گرفتند. گروه D شامل پنج ایزوله می­باشد که الگوی تخمیر قندی تقریبا مشابهی با دو سویه استاندارد لاکتوباسیلوس دایورجنس و لاکتوباسیلوس کونفیوسوس نشان دادند. ایزوله LA3 به تنهایی در گروهE  قرار گرفت و جهت شناسایی دقیق­تر به توالی­یابی ارسال گردید. با رسم دندروگرام سویه­های انتروکوکوس با ضریب تشابه 15 درصد به سه گروه تقسیم­بندی شدند. الگوی قندی ایزوله­های ED1 و ED3 در گروه A مشابه انتروکوکوس دورانس بود. در گروه B  دو ایزولهED2  و  EB3 مشابه هم و مربوط به یک سویه می­باشند و ایزوله­های EB1 و  EB2با ضریب تشابه 8 درصد از انتروکوکوس موندتی جدا شدند.

    در روش­های شناسایی مولکولی و انجام PCR برای ایزوله­های جدا شده، نتایج حاصل، نواربندی تکثیر یافته را در 1500 جفت نوکلئوتید در دو تکرار نشان می­دهد که در شکل 3 آورده شده است.

 

 

 

شکل3 -الکتروفورز محصولات تکثیری توالی­های ژن 16S rRNA  برای ایزوله­های جدا شده لاکتوباسیلوس

  

  با توجه به این­که ایزوله­های جداسازی شده از محصولات لبنی بومی می­باشند و گونه و زیرگونه آن­ها به طور دقیق مشخص نبود، ابتدا به تشخیص جنس باکتری اقدام گردید. به این ترتیب با استفاده از پرایمرهای اختصاصی و با اطمینان بیشتر ایزوله­ها مورد تأیید قرار گرفتند که جهت تشخیص، دو ایزوله LA3 و LB4 از لاکتوباسیلوس­ها برای توالی­یابی ارسال گردید. مقایسات نشان می­دهد که نتایج توالی­یابی برای ایزولهLA3  حاکی از تشابه 100 درصد 1460 نوکلئوتید با توالی 16S rRNA ثبت شده در بانک اطلاعاتی برای لاکتوباسیلوس کازئی زیرگونه 060 بود. بلاست توالی 16S rRNA ایزولهLB4  با توالی موجود در بانک اطلاعاتی نشان داد که این سویه متعلق به لاکتوباسیلوس پلانتاروم زیرگونه KSBT 56 با تشابه 99 درصد می‌باشد که توالی ژن16S rRNA  مربوط به این دو ایزوله در بانک ژنی NCBI در حال ثبت هستند.

 

بحث و نتیجه­گیری

   محصولات لبنی سنتی آذربایجان، منابع با ارزشی جهت جداسازی باکتری­های پروبیوتیک هستند. افزودن این نوع باکتری­ها به عنوان استارتر به پنیر و ماست­های صنعتی این امکان را فراهم می­کند که محصولات لبنی با ویژگی­های مطلوبی به بازار عرضه شود. در ضمن مصرف کنندگان نیز این اجازه را می­یابند که راه جدیدی برای بهره­مندی از سلامتی بیابند. زیرا مصرف این باکتری­ها می­تواند سلامت دستگاه گوارش را بهبود بخشیده و سیستم ایمنی را تقویت کند (Prasad etal., 1998). همچنین در بازار جهانی، پروبیوتیک­های مورد استفاده در صنایع غذایی مانند ماست­های پروبیوتیک، افزودنی­های غذایی و فرمولاسیون­های دارویی از ارزش بسیار بالایی برخوردار هستند (Acharya and Shah, 2002).

    از شاخص­های باکتری­های پروبیوتیک، تحمل شرایط اسیدی و مقاومت به املاح صفراوی است که با تعیین این ویژگی­ها می­توان اختلاف ایجاد شده در بین سویه­های پروبیوتیک را بررسی کرد (Durme et al., 2001). در این پژوهش با استفاده از روش جداسازی ذکر شده 23 ایزوله مقاوم به اسید از محصولات لبنی سنتی شیر و ماست و دوغ مناطق کلیبر، هریس و ورزقان جمع­آوری شده است. با توجه به این­که تحمل محیط اسیدی معده، تنها یکی از ویژگی­های میکروارگانیسم­های پروبیوتیک می­باشد و در صورت نداشتن تحمل بالا به شرایط اسیدی و داشتن سایر خصوصیات پروبیوتیکی مثل مقاومت در برابر نمک­های صفراوی، توانایی کلونیزاسیون به سلول­های اپیتلیال روده­ای و سایر خصوصیات بیولوژیکی مفید، می­توان میکروارگانیسم­های مورد نظر را با استفاده از میکروکپسولاسیون با آلژینات سدیم یا از طریق افزایش دوز مصرفی به دستگاه گوارشی رساند. تحقیقات نشان داده است که میکروکپسولاسیون با آلژینات سدیم به طور مؤثر میکروارگانیسم را از تیمار اسیدی و دمایی در موقع انتقال به روده، بدون تأثیر منفی بر روی عملکرد پروبیوتیکی، حفاظت می­کند (Kim et al., 2006). در دستگاه گوارشی انسان میانگین غلظت نمک­های صفراوی 3/0 درصد وزنی/ حجمی است و برای انتخاب ایزوله­های مقاوم به صفرا، بحرانی تلقی می‌شود. در مطالعه­ای که توسط چاتیو انجام شد، تأثیر نمک­های صفراوی بر روی 38 ایزوله لاکتوباسیلوس مورد آزمایش قرار گرفت. نیمی از ایزوله­های مورد آزمایش به آرامی تحت تأثیر املاح صفراوی 3/0 درصد قرار گرفتند و تأخیر رشد زیر یک ساعت را تا رسیدن به جذب نوری 3/0 در طول موج 600 نانومتر در محیط کشت MRS مایع در مقایسه با کشت کنترل بدون نمک­های صفراوی نشان دادند (Chateau et al., 1994). غلظت 3/0 درصدی از املاح صفراوی نیز در این مطالعه برای ارزیابی قابلیت رشد 23 ایزوله انتخاب گردید که ایزوله­ها با سطوح مختلفی از مقاومت قادر به رشد در این محیط کشت بودند. یافته­های ما در این آزمایش با یافته­های موجود در مطالعات قبلی مطابقت داشت. در مورد همه سویه­های آزمایش شده تأخیر در رشد سویه­های تیمار داده شده با املاح صفراوی نسبت به کشت کنترل مشهود بود. همچنین نوسان در میزان مقاومت در بین گونه­های مختلف مشاهده شد. در بررسی تنوع موجود در دندروگرام مربوط به ایزوله­های لاکتوباسیلی پنج گروه­بندی به دست آمد که بیشترین تنوع مربوط به گروه A می­باشد که به عنوان لاکتوباسیلوس پلانتاروم، لاکتوباسیلوس فرمنتوم و لاکتوباسیلوس برویس تشخیص داده شدند. به دلیل تنوع بیشتر در این گروه ایزوله LB4 جهت انجام شناسایی مولکولی انتخاب شد. همچنین ایزوله LA3 با اختلاف تنوع بیشتری به طور جداگانه در گروه E قرار گرفت و برای شناسایی مورد آزمایش مولکولی جهت تعیین توالی نوکلئوتیدی قرار گرفت. در دندروگرم مربوط به تست­های بیوشیمیایی ایزوله­
های انتروکوکسی نیز سه گروه­بندی حاصل شد. گروه A الگوی نزدیکی با انتروکوکوس دورانس نشان دادند. گروه C نیز خصوصیات مشابه با انتروکوکوس موندتی را نشان داد و ایزوله­های گروه B با ضریب تشابه 17 درصد از گروه C جدا شدند.

     شناسایی فنوتیپی باکتری­های اسید لاکتیک بیشتر براساس مورفولوژی سلولی و تفاوت در سوبستراهای کربوهیدراتی انجام می­شود، اما در روش­های شناسایی فنوتیپی عدم تکرارپذیری نتایج در همه آزمایشگاه­ها مشکل­ساز می­باشد. زیرا علاوه بر متفاوت بودن شرایط کشت در هر آزمایشگاه، تنوع گونه­ها نیز زیاد می­باشد (Ayele et al. 2001). بنابراین شناسایی دقیق­تر توسط روش­های مولکولی انجام گرفته است که قدرتمندترین و صحیح­ترین روش، تفریق سویه­ها است (Coeuret et al., 2003). تحقیقات متعددی جهت شناسایی باکتری‌های لاکتوباسیلوس با استفاده از توالی­یابی ژن 16S rRNA صورت گرفته است. در مطالعه­ای بر روی محصولات لبنی کلومبیا، 17 ایزوله جداسازی شد و شناسایی براساس تست­های بیوشیمیایی و توالی­یابی ژن 16S rRNA انجام گردید و نشان داده شد که فراوان‌ترین باکتری­های پروبیوتیک شناسایی شده لاکتوباسیلوس دلبروکی و استرپتوکوکوس ترموفیلوس بودند (Perea et al., 2007).

   در این تحقیق با استفاده از توالی­یابی ژن 16S rRNA، ایزوله LA3 جدا شده از شیر سنتی شهرستان کلیبر به عنوان لاکتوباسیلوس کازئی 060 و ایزوله LB4 جدا شده از ماست سنتی شهرستان ورزقان به عنوان لاکتوباسیلوس پلانتاروم KSBT 56 شناسایی شدند که با نتایج به دست آمده از تست­های بیوشیمیایی کاملاً مطابقت داشتند.  گونه­های جنس لاکتوباسیلوس میکروارگانیسم­های پروبیوتیک  مطرح شده در دنیا هستند که به عنوان استارتر در صنعت غذا مورد استفاده قرار می­گیرند (Cakir, 2003;  Aquilanti et al., 2007).

نائول و همکاران (2011) از محصول لبنی سنتی موراکان، 18 ایزوله مربوط به سویه­های لاکتوباسیلوس پلانتاروم، لاکتوباسیلوس برویس و لاکتوباسیلوس پاراکازئی شناسایی کردند که همگی مقاوم به اسید معده و نمک­های صفراوی بوده و فعالیت آنتاگونیستی قوی نسبت به باکتری­های بیماری‌زا نشان دادند.

Dorrit   و همکاران (2013) از لاکتوباسیلوس پلانتاروم IMDO788 به عنوان کشت استارتر در محصولات تخمیری سبزیجات استفاده کردند و نشان دادند که این سویه باعث تسریع فرایند تخمیر و افزایش غلظت و کیفیت محصولات نهایی شده و برای اجتناب از رشد مخمر ضروری می­باشد.

     با توجه به‌اینکه سویه­های لاکتوباسیلوس پلانتاروم و لاکتوباسیلوس کازئی شناسایی شده در این پژوهش دارای خواص پروبیوتیکی از جمله مقاومت به شرایط اسیدی معده و نمک­های صفراوی می­باشند، می­توانند به عنوان کاندید پروبیوتیک معرفی گردند تا بقیه تست­های ایمنی را گذرانده و در صورت تأیید به عنوان استارتر در محصولات لبنی صنعتی مورد استفاده قرار گیرند.

 

سپاسگزاری

    از معاونت محترم پژوهشی دانشگاه شهید مدنی آذربایجان و نیز ریاست محترم پژوهشکده بیوتکنولوژی کشاورزی شمالغرب و غرب کشور بخاطر در اختیار قراردادن امکانات پژوهشی این تحقیق تقدیر و تشکر می‌گردد.

  • ·   میردامادی، سعید و تنگستانی، مهرنوش (1390). شناسایی، جداسازی، تخلیص و بررسی طیف اثر باکتریوسین­های چند سویه لاکتوباسیلوس بومی جدا شده از محصولات لبنی ایران. مجله بهداشت مواد غذایی. جلد یک، شماره 3، صفحات: 55 - 69.

 

  • Acharya, M.R. and Shah, R.K. (2002). Selection of human isolates of bifidobacteria for their use as probiotics. Biochern Biotechnology, 102-103: 81-98.
  • Aquilanti, L., Silvestri, G., Zannini, E., Osimani, A., Santarelli, S. and Clementi, F. (2007). Phenotyoic, genotypic and technological characterization of predominant lactic acid bacteria in Pecorino cheese from central Italy. Journal of Applied Microbiology, 103(4): 948- 960.
  • Ayele, N., Siv, A. and Goran, M. (2001). Randomaly Amplified Polymorphic DNA (RAPD) profiles for the distinction of Lactobacillus species. Antonie van Leeuwenhoek, 79: 1-6.
  • Çakır, I. (2003). Determination of some probiotic properties on Lactobacilli and Bifidobacteria. Ankara University Thesis of Ph.D.
  • Calicchia, M.L., Wang, C.I.E., Nomura, T., Yotsuzuka, F. and Ostato, D.W. (1993). Selective enumeration of Bifidobacterium bifidum, Enterococcus faecium and streptomycin resistant Lactobacillus acidophilus from a mixed probiotic product. Journal of Food Protection, 56: 954-957.
  • Chateau, N., Deschamps, A.M. and Hadj Sassi, A. (1994). Heterogeneity of bile salts resistance in the Lactobacillus isolates of a probiotic consortium. Letters in Applied Microbiology, 18: 42- 48.
  • Coeuret, V., Dubernet, S., Bernardeau, M. and Vernoux, J.P. (2003). Isolation, characterization and identification of Lactobacilli fcusng mainly on cheeses and other dairy products. Journal of Food Protection, 83: 269.
  • Dorrit, W., Silvia, G.T., Medana, Z. and Luc De, V. (2013). Applicability of Lactobacillus plantarum IMDO 788 as a starter culture to control vegetable fermentations.Journal of the Science of Food and Agriculture, 93 (13): 3352- 3361.
  • Durme, C., Mahony, L., Murphy, L., Thornton, G., Morrissey, D. and Hallorari, S. (2001). In vitro selection criteria for probiotic bacteria of human origin: Correlation with In vivo findings. Clinical Nutrition, 73(2): 386- 392.
  • Ebrahimi, T.M., Ouwehand, A.C., Hejazi, M.A. and Jafari, P. (2011). Traditional Iranian dairy products: A source of potential probiotic lactobacilli. African Journal Microbiology, 5(1): 20-27.
  • Erkkila, S. and Petaja, E. (2000). Screening of commercial meat starter cultures at low pH in the presence of bile salts for potential probiotic use. Meat Science, 55: 297-300.
 

  • Garrity, G., Boone M., David, R. and Richard, W. (2004). Bergy,s manual of systemstic bacteriology. 4th Edition, Springer pub. Mishigan.
  • Gilliland, S.E., Staley, T.E. and Bush, L.J. (1984). Importance of the bile tolerance of Lactobacillus acidophilus used as dietary adjunct. Journal Dairy Science, 67: 3045- 3051.
  • Harrigan, W.F. and Mc Cance, M.E. (1976). Biochemical test for bacteria laboratory method in food and dairy microbiology. Academic Press. London, pp. 25- 29.
  • Holzapfel, W.H., Guigas, C. and Franz, C. (2002). General overview of the Enterococci. International Symposium on Enterococci in Foods, 67: 30- 31.
  • Kim, S., Yong Cho, S., Song, O., Shin, I.S., Su Cha, D. and Park, H. (2006). Effect of microencapsulation on viability and other characteristics in Lactobacillus acidophilus ATCC 43121. Food Science and Technology, 41(3): 493- 500.
  • Klaenhammer, T.R. (2000). Probiotic bacteria: today and tomorrow. Journal of Nutrition, 130: 415- 416.
  • Naoual, J., Abdelaziz, B. and Mohammed, B. (2011). Probiotic potential of lactobacillus strains isolated from known popular traditional Moroccan dairy products. British Microbiology Research Journal, 1(4): 79- 94.
  • Tajabady, E.M., Ouwehand, A.C., Jafari, P., Bahrami, H. and Heidary Nasrabadi, M. (2011). Evaluation probiotic effects of lactic acid bacteria isolated from Tarkhineh. International Scientific Conference on Probiotic and prebiotic, Slovakia, June 14-16.
  • Perea Velez, M., Hermans, K., Verhoeven, T.L., Lebeer, S.E., Vanderleyden, J. and Keersmaecker, S.C. (2007). Identification and characterization of starter lactic acid bacteria and probiotics from columbian dairy products. Journal of Applied Microbiology, 103(3): 666- 674.
  • Prasad, J., Gill, H., Smart, J. and Gopal, P.K. (1998). Selection and characterization of Lactobacillus and Bifidobacterium strains for use as probiotic. International Dairy Journal, 8: 993-1002.
  • Saarela, M., Lahteenmaki, L., Crittenden, R., Salminen, S. and Sandholm, T. (2002). Gut bacteria and health foods- the european perspective. International Food Microbiology, 78: 99- 117.
  • Schrezenmeir, J. and Vrese, M. (2001). Probiotics, prebiotics and synbiotics approaching a definition. American Journal of Clinical Nutrition, 73: 361- 364.
  • Wood, B.J.B. and Hozapfel, W.H. (1995). The general of lactic acid bacteria. Blackie Academic and Professional, Glasgow.