مطالعه میزان شیوع آلودگی گوشت‌های گاو تازه عرضه شده در سطح شهرستان سنندج به سالمونلا انتریتیدیس و تایفی موریوم، سال91

نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، واحد سنندج، استادیار گروه بهداشت مواد غذایی، سنندج ، ایران.

2 دانشگاه آزاد اسلامی، واحد دامغان، دانشجوی کارشناسی ارشد علوم و صنایع غذایی، دامغان، ایران

3 دانشگاه آزاد اسلامی، واحد مهاباد، استادیار گروه علوم صنایع غذایی، مهاباد، ایران

چکیده

   سالمونلا یکی از مهمترین عوامل عفونت غذایی است که می‌تواند عوارض مختلفی را در دستگاه گوارش ایجاد کند. گوشت به عنوان یکی از مهمترین عوامل انتقال عفونت سالمونلایی در انسان شناخته شده است. در این مطالعه برای بررسی میزان آلودگی سالمونلایی، 60 نمونه گوشت گاو تازه توزیع شده در سطح قصابی‌ها و فروشگاه‌های عرضه گوشت سنندج در شرایط استریل نمونه‌برداری شده و برای جداسازی سالمونلا کشت داده شده و نتایج با استفاده از PCR مورد ارزیابی قرار گرفت. به منظور تشخیص تائیدی کلنی‌های جداسازی شده به عنوان جنس سالمونلا و تفریق گونه‌های تایفی موریوم و انتریتیدیس با استفاده از روش Multiplex-PCR  از سه جفت پرایمر شامل 138S،S141 اختصاصی ژن InvA، پرایمرهای Flil5، Tym اختصاصی ژن fliC و پرایمرهای Prot6e-5 ، Prot6e-6 اختصاصی ژن Prot6E به ترتیب اختصاصی جنس سالمونلا، گونه‌های تایفی‌موریوم و انتریتیدیس مورد استفاده قرار گرفت. در مجموع نتایج حاصل از کشت میکروبی 12 نمونه (20%) آلوده به سالمونلا بودند، در حالی که بر اساس آزمایش PCR روی جدایه‌های حاصله در نهایت 7 مورد (6/11%) از نمونه‌ها آلوده به سالمونلا تشخیص داده شدند. 4 مورد (6/6%) از نمونه‌ها آلوده به سالمونلا تایفی موریوم تشخیص داده شدند و از هیچکدام از نمونه‌ها سالمونلا انتریتیدیس جدا نشد (0%). این مطالعه نشان داد که میزان شیوع آلودگی سالمونلایی در گوشت تازه گاو توزیع شده در سطح سنندج بالا می‌باشد.

کلیدواژه‌ها


عنوان مقاله [English]

Contamination of Fresh Beef to Salmonella typhimurium and Salmonella enteritidis in Sanandaj during 2012

نویسندگان [English]

  • H Karimi Darehabi 1
  • F Esmailneshad 2
  • K Ebrahimi mohammadi 3
1 Assistant Professor of Food Hygiene Department, Faculty of Veterinary Science, SanandajBranch, Islamic Azad University, Kurdistan, Iran.
2 Member of young Researchers Club, Islamic Azad University, damegan,Iran
3 Department of food science and technology, Faculty of agriculture, Islamic Azad University, mahabad branch, Iran.
چکیده [English]

   Salmonella infection is among the main food-borne gastrointestinal disease. Meat has been recognized as a major source of human illness caused by Salmonella serovars. The presence of Salmonella was detected in 60 samples of fresh beef from retailsof Sanandaj. The presence of Salmonella was assessed by conventional culture method and confirmed by PCR assay. To confirm the identification of isolated colonies as Salmonella spp. and determining serovars as typhimuriumand enteritidisserovars, a multiplex PCR  assay, using three pairs of primers were employed. S141 and S139 for InvAgene, specific for the genus of Salmonella, Fli15 and Tym for FliCgene, specific for typhimurium serovar and Prot6e-5 and Prot6e-6 for Prot6E gene, specific for Enteritidisserovar.12 samples 20% were determined as contaminated with Salmonella sppwith microbial culture method but with PCR method only seven samples 11.66% were confirmed. 4 samples (6.6%) of isolated colonies were confirmed as SalmonellaTyphimuriumand  any number of isolated colonies were confirmed as Salmonella Enteritidis , the other isolated colonis were belong to other salmonella serovars. This study showed a relatively highprevalence of salmonella in fresh beef from Sanandaj.

کلیدواژه‌ها [English]

  • beef
  • Salmonella typhimurium
  • Salmonella Enteritidis
  • Multiplex PCR

مقدمه

   سالمونلا یکی از عوامل مهم عفونی در ایجاد عفونت غذایی در دنیا می‌باشد. مواد غذایی با منشاء دامی منبع مناسبى برای رشد سروتیپ‌های مختلف سالمونلا بوده که از این رو غذاهایی از قبیل گوشت گاو، ماکیان و فرآورده‌های گوشتی منشاء ایجاد کننده سالمونلاهای غیرتیفوئیدی در انسان می‌باشند .(Ziemer et al., 2003) سروتیپ‌هایی مانند سالمونلاتایفی و سالمونلا پاراتایفی بیشتر با انسان سازگار بوده و در میزبان‌های غیر انسانی بیماری ایجاد نمی‌کنند .(Nosrat et al., 2012) بعضی از سویه‌های سالمونلا به عنوان سویه‌های مشترک نام برده می‌شوند که می‌توانند بهداشت عمومی را تهدید نمایند و احتمال انتقال سالمونلاهای مقاوم و دیگر پاتوژن‌های باکتریایی مشترک بین انسان و دام را باعث شوند Saroj et al., 2008; Abubakar., 2007)). در آمریکا و کشورهای اروپایی سالمونلا انتریتیدیس و تایفی موریوم در مقایسه با سروتیپ‌های مختلف سالمونلا نقش بیشتری را در ایجاد عفونت غذایی دارند. آلودگی سالمونلایی در انسان به صورت گاستروآنتریت، تب تیفوئید و گاهی اوقات سپتی سمی بروز می‌کند (Ahmadi et al., 2009). شناسایی دام‌های آلوده به عفونت‌های سالمونلایی و جدا کردن آنها از سایر دام‌ها، نظارت کامل بر بازرسی قبل از کشتار، مراحل مختلف کشتارگاهی، نحوه توزیع و نگه‌داری گوشت و جلوگیری از آلودگی تقاطعی از مهمترین روش‌ها می‌باشد که می‌تواند میزان شیوع عفونت غذایی را در مصرف‌کننده کاهش یابد (deFreitaset al., 2010). شناسایی سالمونلا در گوشت و بسیاری از مواد غذایی به طور معمول از طریق کشت میکروبی انجام می‌گردد، اما این روش‌ها زمان‌بر و دقت و حساسیت کافی را ندارند (Ziemer et al., 2003). امروزه با کشف روش‌های سریع تشخیصی مولکولی این مشکلات تا حد زیادی مرتفع گردیده است. به منظور  افزایش ویژگی و کاهش زمان انجام آزمون از روش‌های دیگری مانند جستجوی ژن‌های مربوط به این ارگانیسم‌ها از طریق روش PCR به عنوان روش تائیدی استفاده می‌شود.

   هدف از انجام این مطالعه ارزیابی درصد آلودگی گوشت گاو توزیع شده در سطح قصابی‌ها و فروشگاه‌های سنندج با استفاده از روش کشت استاندارد مرسوم و تأئید آن با روش Multiplex-PCR با استفاده از پرایمرهای اختصاصی جنس سالمونلا و پرایمرهای اختصاصی گونه‌های سالمونلا تایفی موریوم و انتریتیدیس  بود.

 

مواد و روش‌ها

   در این مطالعه 60 نمونه گوشت گاو از نقاط سر دست، ران و قلوه‌گاه به صورت تصادفی از قصابی‌ها و فروشگاه‌های عرضه گوشت سطح شهرستان سنندج در شرایط استریل نمونه‌برداری و در مجاورت یخ به آزمایشگاه ارسال گردید. مقدار 25 گرم از نمونه‌های اخذ شده را بعد از یکنواخت کردن به بطری‌های حاوی 225  میلی لیتر Lactose Broth (Merck, Germany) انتقال داده و به مدت 24 تا 48 ساعت در  37 درجه سلسیوس گرم‌خانه‌گذاری شدند. بعد از بهم‌زدن بطری‌ها به میزان 1 میلی‌لیتر از هر بطری با رعایت شرایط استریل به لوله‌های محتوی 10 میلی‌لیتر محیط کشت Selenite Cystine Broth (Merck, Germany) منتقل، سپس لوله‌های حاوی Selenite Cystine Broth را در 37 درجه سلسیوس به مدت 24 ساعت گرمخانه‌گذاری شدند .(Jamshidi, 2011) لوله‌های کدر در مرحله دوم به وسیله ورتکس تکان داده شده و با استفاده از لوپ تلقیح در پلیت‌های حاوی محیط کشت جامد انتخابیsalmonella shigella agar (Merck, Germany) کشت خطی داده و در 37 درجه سلسیوس به مدت 24 تا 48 ساعت گرمخانه‌گذاری شدند. برای تأئید کلونی‌های با مرکز سیاه حاصله را بر روی محیط کشت‌های افتراقی TSI (triple Sugar Iron agar)، LIA (Lysine Iron agar) و Urea Agar کشت داده شد. نمونه­های اوره منفی، لاکتوز منفی، H2S مثبت و لایزین مثبت به عنوان سالمونلا فرض گردیدند (Jamshidi, 2011; Lukinmaa, 2004).

 

استخراج DNA

   هر کدام از کلونی‌های خالص شده را به 5/1 میلی لیتر Lactose Broth انتقال داده و 24 ساعت در37 درجه سلسیوس گرم‌خانه‌گذاری کرده و سپس با دور 7500 برای 10 دقیقه سانتریفیوژ کرده و در مرحله بعد به رسوب حاصله 100 میکرولیتر بافر پروتئاز و 5 میکرولیتر پروتئاز اضافه و به طور کامل به همزده و به مدت 30 دقیقه در C˚55 قرار داده شد. 100 میکرولیتر از هر نمونه را با 400 میکرولیتر از محلول لیزکننده مخلوط کرده و برای 15 تا 20 ثانیه ورتکس شد. در مرحله بعد 300 میکرولیتر از محلول رسوب‌دهنده را به مخلوط اضافه کرده و به وسیله حرکت دورانی به مدت 3 تا 5 ثانیه مخلوط شد و در دمای20- درجه سلسیوس برای 20 دقیقه قرار داده شد. سپس در دور 12000 برای 10 دقیقه سانتریفیوژ شده و مایع رویی خالی کرده و یک میلی لیتر بافر شستشو به رسوب حاصله اضافه و برای 5-3 ثانیه مخلوط شد و به مدت 5 دقیقه در دور 12000 سانتریفیوژ شد، سپس بافر شستشو را به طور کامل خالی کرده و برای 5 دقیقه در 65 درجه سلسیوس قرار داده شد تا خشک شود. ماده ته نشین در 30 میکرولیتر از بافر حل کننده به وسیله تکان دادن آرام و قرار دادن در 65 درجه سلسیوس برای مدت 5 دقیقه به طور کامل حل شد. مواد غیرمحلول با سانتریفیوژ به مدت 30 ثانیه در دور 12000 ته نشین شد. ماده شناور رویی حاوی DNA  خالص است. غلظت DNA بعد از الکتروفورز در روی ژل الکتروفورز تازه 1 درصد اندازه گیری شد.

 

آزمایش مولتی پلکسPCR

   تست PCR در حجم نهایی 25 میکرولیتر شامل: PCR buffer (l𝜇5/2)، TaqDNApolymerase (l𝜇5/0) (Fermentase)،MgCl2 (l𝜇5/1)، dNTPs (l𝜇1)، هر کدام از پرایمرها با غلظت 10 پیکو مول به میزان (l𝜇1) و DNA استخراج شده از هر نمونه به میزان (l𝜇3)، مخلوط واکنش با افزودن آب یون‌زدایی شده به حجم 25 میکرولیتر رسید. پرایمرهایی که ژن invA را مورد هدف قرار می‌دهد اختصاصی جنس سالمونلا و پرایمرهایی که ژن‌های fliC و Prot6E را مورد هدف قرار می‌دهند به ترتیب اختصاصی سرووارهای تایفی موریوم و انتریتیدیس می‌باشند (DeFreitaset al., 2010). تکثیر ژن هدف در ترموسایکلر با برنامه سیکل‌های حرارتی شامل مرحله شروع در دمای 95 درجه سلسیوس به مدت 5 دقیقه، 35 سیکل شامل 94 درجه سلسیوس به مدت 60 ثانیه، 56 درجه سلسیوس به مدت30 ثانیه، 72 درجه سلسیوس به مدت 30 ثانیه و مرحله بسط نهایی در 72 درجه سلسیوس به مدت 10 دقیقه صورت گرفت. در این بررسی از نشانگر bp100 جهت مشخص نمودن اندازه باندها استفاده گردید (Jamshidi, 2011).

 

 

 

 

جدول1: مشخصات پرایمیرهای مورد استفاده جهت تشخیص جنس سالمونلا و سرووارهای سالمونلا  تایفی موریوم و انتریتیدیس (Soumet, 1998)

اندازه محصول
)bp(

ژن هدف

توالی نوکلئوتیدی

پرایمر

284

InvA

GTGAAATTATCGCCACGTTCGGGCAA

S139-F

 

 

TCATCGCACCGTCAAAGGAACC

S141-R

559

fliC

CGGTGTTGCCCAGGTTGGTAAT

Fli 15-F

 

 

ACTCTTGCTGGCGGTGCGACTT

Tym-R

185

Prot6E

ATATCGTCGTTGCTGCTTCC

Prot6e-5-F

 

 

CATTGTTCCACCGTCACTTTG

Prot6e-6-R

 

 

 


یافته‌ها

   در این تحقیق، بر اساس روش کشت از مجموع 60 نمونه مورد آزمایش12 نمونه (20%) آلوده به سالمونلا تشخیص داده شد. بر اساس آزمایشMultiplex-PCR  روی جدایه‌های حاصله در نهایت 7 مورد (7/11%) از نمونه‌ها به عنوان آلوده به سالمونلا مورد تأیید قرار گرفتند. که از این تعداد، 4 جدایه (66/6%) گونه سالمونلا تایفی موریوم بوده و از هیچکدام از نمونه‌ها سالمونلا انتریتیدیس جدا نشد. در ضمن3 مورد (5 %) از نمونه‌ها آلوده به سایر سروتیپ‌های سالمونلا تشخیص داده شدند (شکل 1).

 

 

 

 

 

 

شکل1: نتیجه آزمایش Multiplex PCR با استفاده از پرایمرهای اختصاصی ژن InvA به طول 284 جفت باز اختصاصی جنس سالمونلا، ژن FliC به طول 559 جفت باز اختصاصی گونه سالمونلا تایفی موریوم و ژن Prot6E به طول 185 جفت باز اختصاصی گونه سالمونلا انتریتیدیس. ستون 1: نشانگر DNA با اندازه 100 جفت باز. ستون2، 3، 5 و 6 : نمونه های مثبت سالمونلا تایفی موریوم؛ ستون 4: کنترل منفی.

 


بحث و نتیجه‌گیری

   در مطالعه حاضر، با استفاده از روشPCR ، 7 مورد سالمونلا(66/11%) در نمونه‌های گوشت تشخیص داده شد. ازسال1970 آلودگی به باکتری سالمونلا در گوشت گاو، مورد توجه همگان قرار گرفته و فراوانی آلودگی با سالمونلا در گوشت گاو حدود 6/2% گزارش گردید (Sorensen, 2002).

Sorensen    و همکاران (2002)، گزارش کردند که باکتری سالمونلا تایفی موریوم را به عنوان یکی از عوامل مهم عفونت مواد غذایی ناشی از مصرف گوشت گاو می‌باشد.

 Cason   و همکاران (2004) در بررسی خود بر روى 140 نمونه گوشت، 12 نمونه (6/8%) را آلوده به سالمونلا گزارش کردند. Baumgartner و همکاران (1992) بیان نمودند که در بیشتر کشورها میزان درصد آلودگی به سالمونلا در گوشت طیور در حدود 7/13 تا 66 درصد می‌باشد. این نتایج نشان‌دهنده گسترش وسیع این عامل بیماری‌زا می‌باشد که می‌تواند به طور جدی سلامت مصرف‌کننده را تهدید نماید. Ahmadi و همکاران (2009)، در یک مطالعه برای تشخیص حاملین سالمونلا در گاو و گاومیش از روش‌های کشت میکروبی و PCR استفاده کردند و بیان کردند که میزان آلودگی در گاو 1 % و در گاومیش 3% بوده در صورتی که در کشت میکروبی هیچ مورد مثبتی یافت نشد.

   روش‌های معمول باکتریولوژی که در شناسایی اجرام بیماری‌زا مانند سالمونلا به کار می‌روند، وقت‌گیر و پرهزینه هستند، اگرچه به عنوان روش مناسبی برای شناسایی اجرام مهم بیماری‌زا در مواد غذایی و دامپزشکی مطرح شده‌اند. طی مطالعاتی که Chen و همکاران (1996) بر روی نمونه‌های مواد غذایی برای جداسازی سالمونلا و سایر میکروب‌های عامل بیماری‌زا انجام دادند، به این نتیجه رسیدند که بسیاری از مشکلاتی که در PCR نمونه‌های  مواد غذایی وجود دارد، به وسیله اصلاح در روش‌های استخراج DNA  و تغییر در برنامه حرارتی ترموسایکلر برطرف شده و مطرح نمودند که برای جداسازی انواع میکروارگانیسم‌ها از نمونه‌های شیر خام، گوشت گاو و طیور روش‌های مولکولی قابل اعتمادتر، سریع‌تر و کارآمدتر از روش‌های کشت مرسوم و بیوشیمیایی می‌باشد.

Nosrati    و همکاران (2012) شیوع سروتیپ‌های سالمونلا تایفی موریوم و انتریتیدیس را در مواد غذایی با روش Multiplex-PCR مورد ارزیابی قرار داده و میزان آلودگی گوشت گاو به سالمونلا 8/8 درصد را گزارش داد این در حالی است که در میزان آلودگی در گوشت گاو توزیع شده در فروشگاه‌ها و قصابی‌های سطح شهرستان سنندج 66/11% بوده که این حاکی از وضعیت پایین سطح بهداشتی در این شهرستان می‌باشد. سرد کردن ناقص غذا، پخت ناقص غذا، مصرف ماده غذایی خام آلوده و آلودگی تقاطعی که در آن مواد غذایی آماده مصرف در اثر تماس با مواد غذائی خام آلوده به طور مستقیم و غیر مستقیم آلودگی پیدا می‌کند، از مهمترین عوامل عفونت سالمونلایی هستند (Razavilar, 2002).

   با توجه به تغییرات متنوعی که در خصوصیات باکتری‌های پاتوژن به دلیل جهش‌های ژنتیکی صورت می‌گیرد، این مسئله باعث ایجاد اختلال در تشخیص این باکتری‌ها با روش‌های سنتی مرسوم  می‌شوند، از این رو با بهره‌گیری از روش‌های تشخیصی مولکولی به عنوان روش جایگزین روش‌های مرسوم فعلی می‌توان انواع عوامل بیماری‌زا را سریعتر و با دقت و حساسیت بالا در انواع مواد غذایی تشخیص داد Ahmadi, 2012)). این مطالعه نشان داد که به علت عدم رعایت موازین بهداشتی میزان شیوع آلودگی سالمونلایی در گوشت گاو توزیع شده در سطح سنندج بالا بوده که این می‌تواند باعث بالا رفتن میزان عفونت‌های سالمونلایی در مصرف‌کنندگان شود.

  • احمدی، علی.، قربانعلی‌زادگان، مهدی.، نجفی، علی.، توکلی، حمیدرضا و میرنژاد، رضا (1391) .تشخیص سریع مولکولی سالمونلا تایفی به روش PCR با استفاده از ژن invA در نمونه های مواد غذایی. مجله علمی دانشگاه علوم پزشکی ایلام. دوره 20، شماره 1، صفحه 7-1.
  • جمشیدی، عبداله و نقدیپور، داوود (1390). تعیین آلودگی آب مورد استفاده در سیستم خنک‌کننده لاشه طیور به باکتری‌های جنس سالمونلا و گونه‌های انتریتیدیس و تایفی‌موریوم در کشتارگاه صنعتی شهرستان مشهد با استفاده از Multiplex PCR. مجله تحقیقات دامپزشکی، پیاپی 66، صفحه 152-149.
  • نصرتی، شیما.، سبکبار، آذر سبکبار.، دزفولیان، مهرورز .، تبرایی، بهمن و فلاح، فاطمه (1391). بررسی شیوع سروتیپ‌های سالمونلا تایفی و اینتریتیدیس در مواد غذایی در مرکز درمانی بیمارستان مفید. مجله پژوهشی دانشکده پزشکی دانشگاه شهید بهشتی، دوره 36 ، شماره 1، صفحه 48-43.
  • رضویلر، ودود (1387). میکروب‌های بیماری‌زا در مواد غذایی و اپیدمیولوژی مسمومیت‌های غذایی. چاپ سوم. انتشارات دانشگاه تهران، صفحه 57-47.

 

  • Abubakar, I., Irvine, L., Aldus, C.F., Wyatt, G.M., Fordham, R., Schelenz, S., Shepstone, L., Howe, A., Peck, M.and Hunter, P.R. (2007). A systematic review of the clinical, public health and cost-effectiveness of rapid diagnostic tests for the detection and identification of bacterial intestinal pathogens in faces and food. Health Technology Assessment,11:211-16.
  • Ahmadi, M.,Dalirnaghadeh, B.,ShirzadAski, H. and Khoshbakht, R.(2009). Comparison of polymerase chain reaction (PCR) and conventional cultivation methods for detection of carriers of Salmonella spp. in cattle and buffalo. Comparative Clinical Pathology,19 (3): 251-255.
  • Ahmadi, A., GhorbanaliZadegan, M., Najafi, A. andTavakoli H. (2012).Molecular detection of Salmonella typhi in food samples by PCR using invA Gene.Journal of IlamUniversity of Medical Sciences, 20 (1):1-7[in Farsi].
  • Baumgartner, A., Heimann, P., Schmid, H., Liniger, M. and Simmel, A. (1992). Salmonella contamination of poultry carcasses and human Salmonellosis. Journal of Food Protection, 43: 123-12.
  • Cason, J., Berrang, M., Buhr, R. and Cox, N. (2004). Effect of pre-chill fecal contamination on numbers of bacteria recovered from broiler chicken carcasses before and after immersion chilling. Journal of Food Protection, 67:1829-1833.
  • Chen, S., Yee, A., Griffiths, M., Wu, K.Y., Wang, C.N.,Rahn, K. and De Grandis, S.A. (1996). A rapid, sensitive and automated method for detection of Salmonella species in foods using AG- 9600 AmpliSensor Analyzer. Journal of applied microbiology, 83: 314- 321.
  • DeFreitas, C.G., Santana, A.P., Da Silva P.H., Gonçalves, V.S., Barros Mde, A., Torres, F.A., Murata, L.S.and Perecmanis, S. (2010).PCR multiplex for detection of Salmonella enteritidis, typhi and typhimurium and occurrence in poultry meat. International Journal of Food Microbiology,139: 15-22.
  • Jamshidi, A. and Naghdipour, D. (2011).Contamination of water used for chilling ofpoultry carcasses to S.typhimurium and S.enteritidis using Multiplex PCR method. Journal of Veterinary Research,66: 149-152[in Farsi].
  • Lukinmaa, S., Nakari, U.M., Eklund, M. andSiitonen, A. (2004).Application of molecular genetics methods in diagnostics and epidemiology of food-borne bacterial pathogens. (APMIS) Acta Pathological, Microbiological, et Immunological scandinavia,112:908-29.
  • Nosrati, S., Sabokbar, A., Dezfoolian, M., Tabarraie, B. andFallah, F. (2012).Prevalence of Salmonella enteritidis, typhi and typhimurium from food products in Mofid hospital. Journal of the Faculty of Medicine, Shahid Beheshti University, 36 (1):43-48[in Farsi].
  • Razavilar, V. (2002). Harmful microbial in food and epidemiology food poisoning, Second Edition, Tehran university publication press, pp. 25-85[in Farsi].
  • Saroj, S.D., Shashidhar, R., Karani, M. and Bandekar, J.R. (2008). Rapid, sensitive, and validated method for detection of Salmonella in food by an enrichment broth culture-nested PCR combination assay. Molecular and Cellular Probes, 22: 201-206.
  • Sorensen, O., Van Donkersgoed, J., McFall, M., Manninen, K., Gensler, G. and Ollis, G. (2002). Salmonella spp. shedding by Alberta beef cattle and the detection of Salmonella spp. in ground beef. Journal of food protection, 65: 484-91.
  • Soumet, C., Ermel, G., Rose, N., Rose, V., Drouin, P., Salvat, G. and Colin, P. (1998). Evaluation of a multiplex PCR assay for simultaneous identification of Salmonella sp., Salmonella enteritidis and Salmonella typhimurium from environmental swabs of poultry houses, Letters in applied microbiology, 28: 113-117.
  • Ziemer, C.J. and Steadham, S.R. (2003). Evaluation of the specificity of SalmonellaPCR primers using various intestinal bacterial species, Letters in applied microbiology, 37(6): 463-469.