شناسایی تقلبات موجود در سوسیس و کالباس تهیه شده از گوشت گاو بر اساس شناسایی ژن‌های میتوکندریایی گونه‌های حیوانی در استان تهران

نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه‎ ‎آزاد‎ ‎اسلامی،‎ ‎واحد‎ ‎علوم‎ ‎و‎ ‎تحقیقات‎ ‎تهران، دانشکده‎ ‎کشاورزی و منابع طبیعی،‎ ‎استادیار گروه علوم‎ ‎و‎ ‎صنایع‎ ‎غذایی، تهران، ایران.

2 - دانشگاه‎ ‎آزاد‎ ‎اسلامی،‎ ‎واحد‎ ‎پرند، استادیار گروه زیست شناسی،‎‎ پرند، ایران

3 دانشگاه‎ ‎آزاد‎ ‎اسلامی،‎ ‎واحد تهرا ن مرکزی، استادیار گروه زیست شناسی،‎‎ تهران، ایران.

4 - دانشگاه‎ ‎آزاد‎ ‎اسلامی،‎ ‎واحد‎ ‎علوم‎ ‎و‎ ‎تحقیقات‎ ‎تهران، دانشکده‎‎ علوم و مهندسی صنایع غذایی،‎ استادیار گروه علوم‎ ‎و‎ ‎صنایع‎ ‎غذایی، ‎تهران، ایران.

چکیده

‏‏   هدف از این مطالعه توسعه روش PCR‎ خاص گونه‌ها برای شناسایی دقیق و سریع گوشت گونه‌های حیوانی در فرآورده‌های گوشتی برای تشخیص تقلبات احتمالی در این محصولات است. برای تعیین گوشت گاو و مرغ، پرایمرها بر اساس ژن سیتوکروم bمیتوکندریایی طراحی و قطعات bp274 وbp 183به ترتیب برای گوشت گاو و مرغ تکثیر گردید. از ده برند مختلف سوسیس تهیه شده از گوشت گاو در سرتاسر استان تهران نمونه‌گیری گردید. نتایج ‏PCR‎‏ اختصاصی نشان داد، تمام نمونه‌ها برخلاف بر چسب‌شان حاوی آلایشمرغی بودند و ‏احشای گاوی در پنج نمونه تشخیص داده شد.‏ به‌علاوه، روش PCR‎ قادر است بدون واکنش متقاطع گونه‌های گوشتی را شناسایی کند. این تکنیک به علت سرعت، سادگی، حساسیت و اختصاصی بودن،پتانسیل بالایی برای تشخیص تقلبات‏ گوشتی در سوسیس دارد.‏

کلیدواژه‌ها


عنوان مقاله [English]

Fraud identification in beef sausage in Tehran ‎province using mitochondrial genes of animal species

نویسندگان [English]

  • H.S , Hosseni 1
  • F Tafvizi 2
  • M Tajabadi Ebrahimi 3
  • A Sharifan 4
1 - Assistant Professor of Food Science and Technology, College of Agriculture & Natural Resources, Science and Research Branch, Islamic Azad University, Tehran, Iran.
2 Assistant Professor, Department of Biology, Parand Branch, Islamic Azad University, Parand, Iran
3 - Assistant Professor, Department of Biology, Central Tehran Branch, Islamic Azad University, Tehran, Iran
4 Assistant Professor of Food Science and Technology, College of Food Science and Industrial, Science and Research Branch, Islamic Azad University, Tehran, Iran
چکیده [English]

   The aim of this study was to develop a species-specific PCR method for rapid identification of meat species in order to detect any potential fraud in meat products. For cattle and poultry, a set of primers were designed based on the mitochondrial cytochrome b and subsequently a 183 bp as well as 274 bp fragments were amplified for poultry and beef samples, respectively. For the study, ten different brands of beef sausage were obtained across Tehran province. Results of PCR assay demonstrated that unlike their labels, all of the samples were contained poultry residuals‎. Moreover, beef offal was detected only in five samples‎. Since no cross-reaction was observed among the different samples, PCR could be considered as a sensitive and ‎specific method for the identification of meat varieties. In addition, high-speed operation and easiness of the technique are the other advantages of PCR method. Therefore, this technique has the capability for sensitive and ‎specific detection of meat adulteration in sausages. 

کلیدواژه‌ها [English]

  • sausages
  • Fraud identification‎
  • Meat species identification
  • PCR

مقدمه

‏ شناسایی گونه‌های مواد غذایی مساله بسیار مهمی برای ارزیابی ترکیبات غذایی و ارائه اطلاعات صحیح ‏مربوط به مصرف‌کننده است. ‏مقررات برچسب‌زنی مواد غذایی نیازمند این است که گوشت گونه‌های حیوانی ‏در ‏محصولات گوشتی به درستی و بادقت به مصرف‌کننده اعلام شود. که این امر منجر به پیدایش روش‌های ‏قابل اعتماد و مخصوص برای تعیین گوشت گونه‌های حیوانی در محصولات مختلف غذایی شده است، زیرا گوشت ‏در این محصولات در طی فرآوری خرد شده با دیگر ترکیبات مخلوط می‌شود وتحت فرایند حرارتی ‏قرار می‌گیرد. شاید صنایع گوشت بیشترین ‏امکان تقلب را در بین گروه‌های مختلف مواد غذایی داشته باشند زیرا که مواد ‏اولیه پس از مخلوط شدن و ‏یکنواخت شدن، در ظاهر قابل شناسایی نیستند (Isabel ‎Mafra et ‎al., 2007). ‎

   جنبه‌‏های مختلفی مثل منبع، ‏قیمت، عوامل مذهبی، سیستم‌های تولیدی و ایمنی بر ‏مقبولیت ‏گوشت به وسیله مصرف‌کننده اثر می‌گذارند‎.‎ تقاضا و قیمت گوشت با توجه به منابع حیوانی متنوع است. جایگزینی گوشت ‏گران‌تر با ‏گوشت ارزان‌تر یکی از مهم‌ترین مشکلات بزرگ صنعت گوشت است. شناسایی منشاء گوشت گونه‌های حیوانی ‏خصوصاً جهت آنالیز مواد غذایی و همچنین رعایت برخی از مقررات مذهبی بسیار مهم است ‏اصطلاح " گوشت گونه‌های حیوانی (Meat species)" به طیف گسترده‌ای از گونه‌های حیوانی شامل پستانداران، پرندگان و ‏حیوانات دریایی اشاره ‏دارد (Pattersan, 1985). ‎

   در نتیجه شناسایی تقلب در این محصولات بدون روش‌های آنالیتیکی مطمئن ممکن نیست. تکنیک‌های آنالیتیکی شامل روش‌های مبتنی بر پروتئین و ‏DNA‏ است ((Leighton Jones 1991; Meyer and ‎Candrian, 1996. ‏‎ روش‌های بر اساس پروتئین، شامل تکنیک‌های مختلف الکتروفروتیکی مثل (King and Kurth, 1982)‎‎isoelectric focusing (IEF) ‎، ‏dodecyl sulfate (Craig et al., 1995)‎‏ ‏‎polyacrylamide sodium‏ و ‏HPLC‏ (‏Schonherr, 2002‎‏) است، که برای ‏مخلوط‌های گوشتی و شناسایی گونه‌ها در محصولات گوشتی حرارت‌دیده مناسب نمی‌باشد. زیرا روش‏های مبتنی بر پروتئین وابسته به بافت بوده و در اثر حرارت بافت تخریب شود و باعث دناتوره شدن ‏پروتین می‌شود. اخیراً به تکنیک‌های مولکولی مثل ‏PCR‏ به دلیل اینکه ‏DNA‏ مولکول‎ ‎‏نسبتاً پایداری است و ‏خیلی بهتر قادر به مقاومت در برابر فرایند حرارتی است حتی اگر به شکل قطعه‌ای باشد، توجه ویژه‌ای شده ‏است. ‏‎روش‌های ‏مولکولی مثل هیبدریداسیون ‏DNA‏‏‎(Ebbehoj et al., 1991a; Ebbehoj et al.,1991 b; Hunt et al., 1997) ‎‏، [SSCP]‏‎ (Rehbein et al., 1997) ‎،‏‏RAPD–PCR] ‎‏[ Calvo et al., 2001)‏‎ ‎‎)، [RFLP]یا توالی‌یابی [Multiplex PCR], (Fajardo et ‎al., 2006)‏‎ [real-time PCR], (Dalmasso et ‎al., 2004; Bottero et al., 2003a; Matsunga et al., 1999) (Sonia Soares et al., 2013; Sakalar Ergün et al., 2012‎) وPCR اختصاصی گونه‌ها، این روش برای شناسایی گونه‌های مختلف پستانداران و ماکیان استفاده شده در محصولات گوشتی بکار برده شده است (Che Man et al., 2007; Arslan et al., 2006; Meyer et al., 1995). در مطالعات اخیر، روش PCRاختصاصی خاص گونه‌ها برای اعتبارسنجی گوشت و محصولات گوشتی بر اساس DNA میتوکندریایی توسعه یافته است (Doosti et al., 2011; Yusop et al., 2012).‎ ‎

   در این تحقیق روش  PCRاختصاصی گونه‌ها با استفاده از پرایمرهای خاص گونه‌های ‏گوشتی‏ (مرغ، گاو) برای شناسایی منشاء گوشت گونه‌های حیوانی استفاده شده ‏در سوسیس حرارت دیده بکار برده شد.

مواد و روش‌ها

 

نمونه برداری

   در مرحلۀ اول نمونه‌برداری از گوشت مرغ و گاو به عنوان شاهد نمونه‌برداری شد. در مرحلۀ دوم نمونه‌برداری 10 برند مختلف سوسیس 55% گوشت قرمز از سراسر استان تهران جمع‌آوری شد. و با حروف لاتین A, B, C, …, J  نام‌گذاری شد. نمونه ها در دمای°C ‎ ‎20- برای استخراج DNA‎ نگه‌داری شد تا از تجزیه آنزیمی DNA‎ جلوگیری شود. از هر برند سوسیس 3 نمونه تهیه شد.

استخراج DNA‎

   مقدار‎ 2/0 گرم از هر کدام از نمونه‌ها در میکروتیوب‌های ml‎ 5/1 جداگانه قرار داده و به میزان ‎µl‎1000 بافر CTAB‎ (10 ml 1 M Tris HCl pH ‎‎8.0, 35 ml 4 M NaCl, 4 ml 0.5 M EDTA pH 0.8, 2 g CTAB‎) و ‎µl‎ 30 پروتئیناز K‎ به آن اضافه و به مدت 3 تا 4 ساعت در بن ماری C°‎‏ 65‎‏ قرار گرفت. در مرحله بعد به هر یک از میکروتیوب‌ها زیر هود، ‎µl‎‏1000 ‏فنل کلرفرم ایزوآمیل الکل اضافه و بعد 10 ‏دقیقه اینورت در سانتریفوژ ‏rpm ‎‏ 12000‏‎ ‎در دمای 4 درجه به مدت 5 دقیقه قرار گرفت. لایه رویی جدا و در میکروتیوب جدید قرار داده شد و به میزان ‎µl‎‏600 ایزوآمیل الکل ‏به آن اضافه و مرحله قبل تکرار گردید. در مرحلۀ بعدی برا ی حذف املاح و تغلیظ DNA‎ به آن اتانول 100% و 70% در مراحل بعدی اضافه و سپس کل محتویات را خالی کرده‏ و بعد از خشک کردن به میزان ‎µl‎‏50 به آن اضافه شد DNA های استخراجی به وسیلۀ دستگاه نانودراپ مورد ارزیابی کمی قرار گرفت و در ‎ C°‎‏ 20-  نگه‌داری شد et al., 1989) Sambrook‏‏(.

   نتایج آزمایش کمی (نانودراپ) بر روی ‏DNA‎‏ استخراج شده ‏بیانگر این بود که میزان جذب ‏محلول ‏DNA‏ ‏در محدودۀ 2- 7/1 قرار داشت. ‏که نشان‌دهنده کمیت بالای ‏‎ DNA‎‏استخراجی است. در ‏حقیقت نتایج ‏استخراج ‏DNA‎‏ از نمونه‌های گوشت خام (شاهد) و 10 برند ‏سوسیس، نشان داد که ‏‎ ‎DNA‎‏استخراج ‏شده برای تکثیر ‏PCR‎‏ مناسب بود. ‏

   پرایمرهای الیگونوکلئوتید‎ پرایمرهای اختصاصی خاص گونه‌های مرغ و گاو برای تشخیص گونه‌های موجود در نمونه‌ها، از ژنوم ‏مختلف میتوکندریایی بر طبق سکانس‌های موجود در بانک اطلاعات ژن، استفاده شد.

 

 

 

 

 

 

 

جدول 1- توالی پرایمرها و اندازۀ قطعات تکثیر یافته با هر پرایمر در هر گونه

References

Amplicons

Sequences

Genes

Species

Primers

‎‏‏ ( Dalmasso et al., 2004(‏‎‎ ‏‎ ‎

183bp

5' TGAGAACTACGAGCACAAAC 3'

5' GGGCTATTGAGCTCACTGTT 3'

12S rRNA

Gallus gallus

پرایمر ماکیان

(Matsunaga et al.,1999) ‎‏

274bp

5'GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA3'

5'CTAGAAAAGTGTAAGACCCGTAATATAAG-3'

cytochrome b

Bos taurus

پرایمر گاوی

 

PCR


   پرایمرهای اختصاصی گونه‌ها و شرایط بهینه ‏PCR‏ برای تشخیص گونه‌های گاو و ماکیان در نظر گرفته شد. ‏برای تعیین ‏اختصاصی ‏بودن پرایمرهای خاص گونه‌های گوشتی شاهد مورد استفاده در این تحقیق (گاو و مرغ)، پرایمر خاص هر گونه ‏همراه با ‏DNA‏ دیگر ‏گونه گوشتی ‏ PCR‏انجام ‏گردید‏‎.‎‏ ‏تکثیر PCR در حجم نهایی µl 25 شامل µl 5/2 بافر ‎10x‎ (pH 8.8) ‎(Fermentas, USA) ‎PCR ،µl‎‏ 5/0 از آنزیم‏Taq DNA (Fermentas, USA) ‎Polymerase ، µl 5/0 از dNTPs و  µl25/1 MgCl2 ‎(Fermentas, USA) ‎، ‎µl‎‏ 5/0 ‏از پرایمرها و  µl1 از DNA نمونه‌ها انجام شد. واکنش PCR در دستگاه ترموسایکلر (Bio Rad, USA)‏ طبق چرخه دمایی مرحلۀ دناتوراسیون ابتدایی در °C 95 برای 1 دقیقه، 30 چرخه اتصال (Annelling) ‏به شرح زیر برنامه‌ریزی شد: ‎°C‎‏ 95 ‏برای 1 دقیقه، °C 60 برای 1 دقیقه، °C 72 برای 90 ثانیه و مرحله ساخت و گسترش (Extension) نهایی در ‎°C‎‏ 72 برای 5 دقیقه انجام گرفت. محصول PCR بر روی ژل آگارز 2%  شامل بافر XTBE2 مشخص شد و به وسیلۀ دستگاه ژل داک با اشعه UV مشاهده شد. ‏همچنین ‏ ‎PCR‏ با هر کدام از پرایمرهای خاص گونه‌ها، بر روی ‏DNA‏ استخراجی 10 برند سوسیس هم انجام ‏گرفت. ‏این آزمایش حداقل سه بار برای هر کدام از برندها تکرار شد (Ghovvati et al., 2008).

 

یافته‌ها

‏‏‏ PCR اختصاصی

   در مرحلۀ ابتدایی این تحقیق،‎ PCR ‎بر روی ‏DNA‏ ‏گوشت‌های خام (شاهد) استخراج شده با ‏پرایمرهای اختصاصی هر گونه انجام گردید. پرایمر‎ ‎اختصاصی ماکیان و گاو به ‏ترتیب قطعات ‏bp ‏183،‏ bp 274 را تکثیر کردند. برای تشخیص واکنش متقاطع ‏DNA‏‌های گونه‌های ‏دیگر با پرایمر اختصاصی هر گونه، ‏ PCR‎‏ با‎ DNA غیرهدف گونه‌ها ‏انجام گردید‎ که اختصاصیت پرایمر هر کدام از گونه‌ها به ‏اثبات رسید. این آزمایش حداقل سه بار تکرار شد، که ‏نتایج در تمام آزمایش‌ها یکسان بود که نشان‌دهنده تکرار پذیر بودن این آزمایش بود.

   ‏‎‏DNA‎, PCR‏ ‏10 ‏برند‏‎ ‎سوسیس با پرایمر اختصاصی ماکیان ویژه ناحیه ژن12S rRNA ‎ (شکل1) DNA ‎PCR‏ ‏10 برند‏‎ ‎سوسیس با پرایمر ‏اختصاصی گاو ویژه ناحیه ‎ cytochrome b‏در (شکل2) قابل مشاهده است.‏

 

 

 

 


شکل 1- ‏Simplex PCR‏ 10 برند سوسیس با پرایمر اختصاصی ماکیان جهت تکثیر قطعۀ ‏bp‏ 183 ژن‏‎12S rRNA ‎‏ میتوکندریایی روی ژل ‏آکارز2% ‏‏: نمونه‌های 1 تا 10 به ترتیب شامل نمونه‌های ‏A‏ تا ‏J‏ می‌باشد‏؛ شماره‌های 11 و 12 به ترتیب نمونه‌های شاهد مثبت DNA‏ مرغ و منفی‏‏؛ M‏: مارکر‎ bp ‎‏50‏.‏

 

شکل2- ‏‎ Simplex PCR‏ 10برتد سوسیس با پرایمر اختصاصی گاو جهت تکثیر قطعۀ ‏bp ‏274 ژن ‏cytochrome b‏ میتوکندریایی بر روی ‏ژل آکارز 2%: نمونه‌های 1 تا 10 به ترتیب شامل نمونه‌های ‏A‏ تا ‏J‏ می‌باشد؛ شماره‌های 11 و 12 به ترتیب نمونه‌های شاهد مثبت DNA‏ گاو و منفی؛ ‏M‏: مارکر‎ bp ‎‏100‏.‏

 

  

 

   نتایج حاصل از تکثیر ‏قطعۀ ‏bp 183 ناحیۀ ژن‏‎12S rRNA ‎‏ ‏میتوکندریایی در شکل (1) در تمام نمونه‌ها تکثیر شده است که نشان‏دهنده وجود اجزای مرغی در تمام نمونه‌ها می‌باشد. تکثیر قطعۀ ‏bp ‏274 ژن ‏cytochrome b‏ میتوکندریایی‏ در شکل 2 نمایش داده ‏شده ‏است، بر این اساس، نمونه‌های ‏A,C, D,G,I‏ حاوی گوشت گاو هم بودند. نتایج نشان داد ‏که هیچ یک از نمونه‌ها با اجزای خوکی آلوده نشده بود. اما 40% نمونه‌ها آلوده به ‏اجزای ‏ماکیان بود ‏ولی نمونه‌های گوشت چرخ‌کرده با اجزای ماکیان آلوده نشده بود. ‏  

‏ بحث و نتیجه‌گیری ‏

اخیرا نگرانی‌ها از وجود تقلبات در محصولات گوشتی مخصوصاً سوسیس و کالباس افزایش یافته است، به این دلیل نیاز به شناسایی محتویات محصولات گوشتی برای جلوگیری از تقلبات بکار رفته در این محصولات بیشتر احساس می شود.

   در این تحقیق برای شناسایی گونه‌های گوشتی از ‏DNA‏ میتوکندریایی استفاده شد. زیرا ‏DNA‏ ‏میتوکندریایی به دلیل ویژگی‌های منحصر به فرد وراثت مادری، تعداد کپی‌های بالا از هر سلول، سرعت بالای جهش و ‏این که این ژن به‎ ‎ندرت‎ ‎دچار‎ ‎نوترکیبی ‎می‌شود منحصر‎ ‎به‎ ‎فرد‎ ‎می‎ ‎باشد، پلی مورفیسم ‏DNA‏ میتوکندریایی به طور گسترده برای ‏شناسایی گونه‌ها استفاده می‌شود. داده‌های ‏DNA‏ میتوکندریایی می‌تواند به شناسایی گونه‌های حیوانی از ‏قطعات بافت کمک کند. توالی‌های ناقص و کامل ‏DNA‏ میتوکندریایی در خیلی از حیوانات تشخیص داده ‏می‌شوند (Umetsu et al., 2005). نشان داده شده که مقاومت حرارتی و تعداد کپی‌های ‏زیاد ‏DNA‏ میتوکندریایی در بافت گوشت به حفظ و بقای قطعات‎ DNAکمک می‌کند تا به اندازه کافی به ‏وسیلۀ ‏PCR‎‏ تکثیر شود. تعداد کپی‌های بالای ‏DNA‏ میتوکندریایی تضمین‌کننده کمیت زیاد و کافی ‏محصول ‏PCR‎‏ حتی وقتی مقدار کمی از نمونه‌های گوشت خام یا فرایند شده استفاده می‌شود، است. زیرا ‏به دلیل تعداد کپی‌های بالای ‏DNA‏ میتوکندریایی، ‏کوچک، دورشته‌ای و حلقوی بودنشان در سلول، شانس ‏بقای آن‌ها تحت شرایط مختلف فرایند کردن، بیشتر است. این دلایل، آن ها را برای شناسایی گونه‌های ‏گوشتی فرایند شده ایده آل ساخته استet al.,2003) ‏‎.(Girish در مطالعات متعدد اثرات روش‌های مختلف پخت بر روی تکثیر PCR، DNA‏ میتوکندریایی ‏استخراج شده از گوشت و محصولات گوشتی بدون هیچ گونه اثرات نا مطلوب،مورد بررسی قرار گرفته است (Mane et al., 2012; Kesmen et al., 2007; Arslan et al., 2006).‎

‎‏‏   بنابراین در این مطالعه روش PCR خاص گونه‌ها برای شناسایی گونه‌های ماکیان و گاو در سوسیس استفاده شد. متمایز کردن گونه‌ها مخصوصاً در نمونه‌های مخلوط مثل سوسیس که در معرض حرارت قرار گرفته‌اند بسیار مشکل است. در این پژوهش، DNA 10 گونه سوسیس استخراج شده با موفقیت برای هر دو گونه ذکر شده مورد شناسایی قرار گرفت، بدون اینکه ادویه اضافه شده و فرآیند حرارتی اثری بر روی تکثیر بگذارد ‎Kesmen et ‎al., 2007)‎‏) و سبب گردید بدون هیچ واکنش متقاطعی قطعات DNA مرغ در تمامی 10 نمونه و قطعات DNA گاو در 5 نمونه تکثیر یابد، همچنین قوتی و همکاران در سال 2008 با استفاده از سه نوع پرایمر خاص گونه‌های ماکیان، نشخوارکنندگان و خوک ‏‎ PCRانجام دادند. از هر کدام منابع غذایی (گوشت چرخ‌کرده، سوسیس ‏و ‏کالباس) 10 نمونه جمع‌آوری کردند و آن‌ها را مورد ارزیابی قرار ‏دادند، در این تحقیق در طی آزمایش ‎ ‎PCR‏گونه‏های ماکیان، پستانداران و خوک در نمونه‌های فرآورده‌های گوشتی صنعتی شناسایی شدند ‏که ‏Multiplex ‎PCR‏ ‏انجام ‏شد. پرایمرها برای ‏ناحیه ‏S rRNA‏12،‎ tRNA Val، ‏S rRNA‏ 16 ژن های میتوکندریایی طراحی ‏شدند (Ghovvati et al., 2008).

   مانه‎ و همکاران هم در سال 2009 از جفت پرایمر طراحی شده بر اساس ژن‎ D-loop ‎میتوکندریایی برای ‏تکثیر قطعاتDNA ‎‏ bp‎‏ 442‏ ‎برای تشخیص گوشت مرغ در گوشت و فرآورده های گوشتی استفاده کردند (Mane et al., 2009). ‎در این تحقیق آنزیم‌های هضمی برای تشخیص بین گونه‌ها بکار برده شد‎. برای شناسایی تقلب بکار رفته در محصولات گوشتی صنعتی در سال 2011 محققینی ازایران روش‎ PCR-‎RFLP ‎را بکار بردند. در این روش‎ ‎برای تشخیص گوشت گاو، گوسفند، خوک، مرغ، االاغ ‏و اسب در ‏‏224 محصولات گوشتی شامل 68 سوسیس، 48 فرانکفورتر، 55 همبرگر، 33 ژامبون و 20 ‏کالباس بکار برده ‏شد. نمونه‌ها از شرکت‌های مختلف و مغازه‌های مواد غذایی در ایران جمع‌آوری شدند. در این مطالعه از آنزیم‌های هضمی بر روی محصول PCR برای تمایز بین گونه‌ها استفاده شد (‎(‎Doosti et al., 2011‎‏.‏ ولی در این مطالعه بدون استفاده از آنزیم بین گونه‌های مختلف گاو و مرغ بدون واکنش متقاطع تمایز ایجاد شد.

   نتایج حاصله از ‎PCR‏ ‏اختصاصی گونه‌های ماکیان و گاو در این تحقیق نشان داد در تمام نمونه‌ها علی‌رغم اینکه بر روی برچسب آنها محتوی 55% گوشت گاو درج گردیده بود، با بقایای مرغ آلوده بود که نشان‌دهنده تقلب در این ‏محصولات است. زیرا با توجه به قیمت پایین اجزای مرغی مخصوصاً خمیر مرغ، استفاده از خمیر ‏مرغ در این محصولات تقلب محسوب می‌شود. ‏بر اساس اصلاحیه شماره 2 استاندارد ملی ایران به شماره 2303 تحت عنوان سوسیس و کالباس، ویژگی‌ها ‏و و روش‌های آزمون، استفاده گوشت‌های قرمز و سفید تهیه شده به روش مکانیکی (خمیر گوشت و ‏خمیر مرغ) در انواع سوسیس و کالباس ممنوع است‎. در حقیقت نتایج بدست آمده نشان داد که روش PCR ‏اختصاصی گونه‌ها، روشی مطمئن، سریع، قابل اعتماد، ارزان و تکرارپذیر ‏برای بررسی تقلبات در محصولات گوشتی حرارت‌دیده مثل سوسیس و کالباس است.‏

 

  • Arslan, A., Irfan, O.I. and Mehmet, C. (2006). Effect of method of ‎cooking on identification ‎of ‎heat processed beef using polymerase chain ‎reaction (PCR) technique. Meat Science, 72: ‎‎326–330.‎
  • Bottero, M.T., Dalmasso, A., Nucera, D., Turi, R.M., Rosati, S., Squadrone, S., Goria, M. and Civera, ‎T. (2003). Development of a PCR assay for the detection of animal tissues in ruminant feeds. Journal ‎of ‎Food Protection, 66: 2307–2312.‎
  • Calvo, J.H., Zaragoza, P. and Osta, R. (2001). A quick and more sensitive method to identify pork ‎in ‎processed and unprocessed food by PCR amplification of a new specific DNA fragment. Journal ‎of ‎American Society of Animal Science, 79: 2108–2112.‎
  • Che Man, Y.B., Aida, A.A., Raha, A.R. and Son, R. (2007). Identification of pork derivatives ‎in ‎food ‎products by species-specific polymerase chain reaction (PCR) for halal verification. Food ‎Control, ‎‎18: ‎‎885–889.‎
  • Chikuni, K., Tabata, T., Saito, M. and Monma, M. (1994). Sequencing of mitochondrial cytochrome ‎‎b genes for the identification of meat species. Animal Science and Technology, 65: 571–579.‎
  • Craig, A., Ritchie, A.H. and Mackie, I.M. (1995). Determining the authenticity of raw reformed ‎breaded ‎scampi (Nephrops norvegicus) by electrophoretic techniques. Food Chemistry, 52: 451–454.‎
  • Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Rosati, S. and Bottero, M. (2004). A multiplex PCR ‎assay ‎for the identification of animal species in feedstuffs. Molecular and Cellular Probes, 18: 81–87.‎
  • Desjardins, P. and Morais, R. (1999). Sequence and gene organization of the chicken mitochondrial ‎‎‎genome. Journal of Molecular Biology, 212: 599–634.‎
  • Doosti, A., Ghasemi Dehkordi, P. and Rahimi, E. (2014). Molecular assay to fraud identification of ‎meat ‎products. Journal of Food Science and Technology, 51(1): 148-152.
  • Ebbehoj, K.F. and Thomsen, P.D. (1991a). Species differentiation of heated meat products by ‎DNA ‎hybridization. Meat Science, 30: 221–234.‎
  • Ebbehoj, K.F. and Thomsen, P.D. (1991b). Differentiation of closely related species by ‎DNA ‎hybridization. Meat Science, 30: 359–366.‎
  • Ergun, S. and Fatih, M.A. (2012). The development of duplex real-time PCR based on ‎SYBR ‎Green florescence for rapid identification of ruminant and poultry origins in foodstuff. ‎Food ‎Chemistry, 130: 1050–1054.‎
  • Fajardo, V., GonzaLez, I., Lopez-Calleja, I., Martian, I., Hernandez, P.E., Garciaa, T.R. and Martian, ‎R. ‎‎(2006). PCR–RFLP authentication of meats from red deer (Cervus elaphus), fallow deer (Dama ‎dama), ‎roe deer (Capreolus capreolus), cattle (Bos taurus), sheep (Ovis aries), and goat (Capra hircus). Agricultural and Food Chemistry, 54: 1144–1150.‎
  • Ghovvati, S., Nassiri, M.R., Mirhoseini, S.Z., Heravi Moussavi, A. and ‎Javadmanesh, A. (2008). ‎Fraud ‎identification in industrial meat products ‎by ‎multiplex PCR assay. ‎Food ‎Control, 20(8): 696–‎‎‎699. ‎
  • Girish, P.S., Anjaneyulu, A.S.R., Viswas, K.N., Anand, M., ‎Rajkumarb, N., Shivakumar B.M. and ‎Bhaskar, S. (2003). Sequence analysis ‎of ‎mitochondrial 12S rRNA gene can identify meat ‎species. ‎Meat ‎Science, ‎‎66: 551–556.‎
  • Hunt, D.J., Parkes, H.C. and Lumley, I.D. (1997). Identification of the species of origin of raw ‎and ‎cooked meat products using oligonucleotide probes. Food Chemistry, 60: 437–442.‎ ‎
  • Kesmen, Z., Sahin, F. and Yetim, H. (2007). PCR assay for the ‎identification ‎of ‎animal species in ‎cooked ‎sausages. Meat ‎Science, 77: 649–653.‎
  • King, N.L. and Kurth, L. (1982). Analysis of raw beef samples for adulterant meat species by ‎enzyme ‎staining of isoelectric focusing gels. Food Science, 47: 1608–1612.‎ ‎
  • Leighton Jones, J. (1991). DNA probes: applications in the food industry. Trends in Food Science and ‎Technology, 2: 28–32.‎
  • Mane, B.G., Mendiratta, S.K. and Tiwari, A.K. (2009). PCR assay for specific identification of ‎chicken ‎species in meat and meat products. Food Chemistry, 116: 806–810.‎
  • Mane, B.G., Mendiratta, S.K. and Tiwari, A.K. (2012). Detection of ‎adulteration ‎of meat and meat products ‎with buffalo meat employing polymerase chain reaction assay, Food Analytical Methods, ‎‎5: 296–‎‎‎300.
  • Mafra, I., Ferreira, P.L.V.O., Beatriz, M. and Oliveira, P.P. (2008). ‎Food ‎authentication by PCR-based methods. European Food Research and Technology, 227: 649–665. ‎
  • Matsunga, T., Chikuni, K., Tanabe, R., Muroya, S., Shibata, K., Yamada, J. and Shinmura, Y. (1999). A quick ‎and simple method for the identification of meat species and meat products by PCR assay. Meat ‎Science, 51: 143–148.‎
  • Meyer, R. and Candrian, U. (1996). PCR-based DNA analysis for the identification and characterization of ‎food components. Lebensmittel-Wissenschaft und Technologie, 29: 1–9.
  • Meyer, R., Hoefelein, C., Luethy, J. and Candrian, U. (1995). Polymerase chain reaction–restriction ‎fragment length ‎polymorphism analysis: A simple method for species identification in food. ‎Journal of AOAC International, 78: ‎‎1542–1551‎.
  • Pattersan, R.L.S. (1985). Biochemical identification of meat ‎species. ‎Elsevier Applied ‎Science ‎Publishers, London, pp‎. 313–315.
  • Rehbein, H., Kress, G. and Schmidt, T. (1997). Application of PCR SSCP to species identification of fishery ‎products. Journal of the Science of Food and Agriculture, 74: 35–41.‎
  • Sambrook, J., Fritch, E.F. and Maniatis, T. (1989). Molecular cloning: A ‎laboratory manual. 2th ‎Edition, ‎ Cold spring Habor ‎Laboratory, New York, pp. 8-113‎‏.‏
  • Sawyer, J., Wood, C., Shanahan, D., Gout, S. and McDowell, D. (2003). Real-time PCR for ‎quantitative ‎meat species testing. Food Control, 14: 579–583.‎
  • Schonherr, J. (2002). Analysis of products of animal origin in feeds by determination of carnosine and ‎related dipeptides by high-performance liquid chromatography. Journal of Agricultural and Food ‎Chemistry, 50: 1945–1950.‎
  • Soares, S., Amarala, J.S., Oliveira, M.B.P.P. and Mafra, I. (2013). A SYBR Green real-time ‎PCR assay to detect and quantify pork meat in processed poultry meat products. Meat Science, 94(1): 115-‎‎120
  • Umetsu, K. and Yuasa, I. (2005). Recent progress in mitochondrial DNA analysis. ‎Legal ‎Medicine, 7: ‎‎259–262.‎
  • Yusop, M.H.M., Mustafa, S., Che-Man, Y.B., Omar, A.R. and Mokhtar, N.F.K. (2012).‎ Detection of ‎raw ‎pork targeting porcine-specific mitochondrial cytochrome B gene by molecular beacon probe real-‎time ‎polymerase chain reaction. Food Analytical Methods, 5: 422–429‎.‎