مطالعه میزان شیوع سالمونلا تایفی‌موریوم در شیرهای خام گاو، گوسفند و بز عرضه شده در استان چهارمحال و بختیاری

نوع مقاله: مقاله پژوهشی

نویسندگان

1 - دانشگاه آزاد اسلامی، واحد شهرکرد، عضو باشگاه پژوشگران جوان و نخبگان، شهرکرد، ایران

2 دانشگاه آزاد اسلامی، واحد شهرکرد، گروه دامپزشکی، دانشیار بهداشت مواد غذایی، شهرکرد، ایران

3 - دانشگاه آزاد اسلامی، واحد شهرکرد، گروه زیست شناسی، استادیار میکروبیولوژی، شهرکرد، ایران

چکیده

   گونه‌های سالمونلابه‌ویژه تایفی‌موریوم و اینتریتیدیس جزو رایج‌ترین عوامل عفونت‌های غذایی در جهان می‌باشند.هدف این مطالعه بررسی میزان شیوع سالمونلا تایفی‌موریوم در شیر خام دام‌های مختلف در استان چهارمحال و بختیاری بود. برای این منظور تعداد 550 نمونه شیر خام (200 نمونه شیر گاو، 175 نمونه شیر بز و 175 نمونه شیر گوسفند) از مهر ماه تا اسفند ماه 1390 از دامداری‌ها جمع‌آوری گردید. سالمونلا تایفی‌موریوم ابتدا به روش کشت جستجو و سپس جدایه‌ها با روش PCR و با استفاده از پرایمرهای اختصاصی ST11و ST15 مورد تأیید قرار گرفتند. بر پایه آزمون کشت از مجموع 550 نمونه مورد بررسی، 20 نمونه (63/3%) آلوده بهسالمونلا تشخیص داده شدند. نمونه‌های آلوده شامل 14 نمونه (54/2%) شیر گاو، 2 نمونه (36/0%) شیر گوسفند و 4 نمونه (72/0%) شیر بز بودند. از 20 جدایه سالمونلا به روش کشت 9 جدایه (63/1%) در PCR به عنوان سالمونلا تایفی‌موریوم مورد تأیید قرار گرفتند. نتایج حاصله از تحقیق نشان داد، درصد نسبتاً بالایی از نمونه‌های شیر خام به سالمونلا تایفی‌موریوم آلوده بوده و این مسأله ضرورت مراعات موازین بهداشتی در حین شیردوشی و حمل و نقل و اجتناب از مصرف خام شیر به خصوص در تولید فرآورده‌هایی مثل پنیر یا بستنی و... را واضح‌تر می‌سازد.

کلیدواژه‌ها


عنوان مقاله [English]

Isolation and identification of Salmonella typhimurium from raw cow, sheep and goat milk in Chahamaha Va Bakhteyari Province

نویسندگان [English]

  • F Tajbakhsh 1
  • E Rahimi 2
  • E Tajbakhsh 3
1 Young Researchers and Elite Club, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran.
2 Department of Food Hygiene, ‍College of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
3 Department of Microbiology, ‍College of Basic Silences, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
چکیده [English]

   Salmonella typhimurium and S. enteritidisare known as the major causes of food-borne infection throughout the world. The present study was carried out to investigate the prevalence of S. typhimurium in raw milks of Chahamaha Va Bakhteyari province. For this reason, a total of 550 raw milks (consisting of 200 cow, 175 sheep and 175 goat milk samples) were collected through October 2011 to March 2012 from dairy herds around Shahrekord. The samples were cultured and the isolated colonies were confirmed by PCR using species-specific ST11 and ST15 primers. According to the results, a total of 20 samples (3.63%) were found positive for Salmonellaspp.Amongst, 14 (2.54%) of cow milk, 2 (0.36%) of sheep milk and 4 (0.72%) of goat milk samples were contaminated. Using PCR, 9 (1.63%) samples were contaminated with S. typhimurium. The results indicated a relatively high occurrence of S. typhimurium in raw milks. Therefore, it is essential to maintain hygienic measures during milking and handling. Besides, it is recommended not to use raw milk for the manufacturing of dairy products such as cheese and ice-cream.

کلیدواژه‌ها [English]

  • Salmonella typhimurium
  • Cow milk
  • Sheep milk
  • Goat milk

مقدمه

   سالمونلوزیس یکی از بیماری‌های عمده ناشی از مواد غذایی است که همواره منجر به نگرانی‌هایی در سطح بهداشت عمومی است (de Freitas et al., 2010). این باکتری با بیش از 2500 سروتیپ، جزء اولین یا دومین عامل بیماری‌های ناشی از مصرف مواد غذایی آلوده در جهان می‌باشد (Foley and Lynne, 2008) و از بین سرووارهای مختلف سالمونلا، سرووارهای اینتریتیدیس وتایفی موریوم در مقام اول عفونت قرار دارند و دارای شیوع گسترده‌ای در آسیا (کره، ژاپن و تایلند و...) می‌باشند (Solhan et al., 2011). اولین گزارش مربوط به شیوع مسمومیت غذایی ناشی از سالمونلا، توسط گارتنر در سال 1888 در آلمان بود (Shapori et al., 2009). در مطالعاتی، شیوع آن 74/1% در آمریکا و 6/8% در ایران گزارش شده است (Jamshidi, 2009; de Freitas, 2010). ناگان و همکاران در 2010 گزارش کردند که این باکتری تقریبا عامل 25 میلیون عفونت و حدود 200000 مرگ در سطح جهان می‌باشد (Nagan et al., 2010). با توجه به میزان عفونت‌های گزارش شده و مرگ و میر بالای حاصل از این پاتوژن، پژوهش‌های فراوانی در خصوص وضعیت آلودگی مواد غذایی مختلف انجام پذیرفته است Saroj et al., 2008)). مطالعات مختلف دلالت بر وجود گسترده باکتری سالمونلا در غذای انسان و خوراک دام دارد. تمامی سرووارهای سالمونلا برای انسان پاتوژن محسوب می‌شوند و بیشترین آلودگی در انسان به دلیل مصرف مواد غذایی پروتئینی است. غذاهایی از قبیل تخم‌مرغ، گوشت و فرآورده‌های گوشتی مانند سوسیس، کالباس، ماکیان و شیر خام و فرآورده‌های آن مانند پنیر، خامه و بستنی از متداول‌ترین منابع آلودگی انسان با سالمونلا می‌باشند (Espie and Vaillant, 2005). تاکنون همه‌گیری‌های مختلفی از سالمونلوز به ثبت رسیده است از آن جمله گزارش‌های شیوع ناگهانی سالمونلوز در ارتباط با مصرف انواع پنیر می‌باشد. بزانسون و همکاران در سال ۱۹۸۴ نشان دادند که علت شیوع سالمونلوز که در چهار ایالت کانادا اتفاق افتاده بود، مصرف پنیر چدار بوده است (Bezanson et al., 1985). بزرگ‌ترین شیوع سالمونلوز با عامل غذایی در ایالات متحده آمریکا رخ داده که۱۶۲۸۴ نفر را مبتلا ساخت (Rayan et al., 1987). یک مورد شیوع سالمونلوز در آمریکا از طریق بستنی آلوده به گزارش شده است که علت آن حمل بستنی با کامیونی بود که تخم‌مرغ آلوده حمل نموده بود Hennessy et al., 1996)).

   با توجه به این که سالمونلا به عنوان یک ارگانیسم مقاوم در مواد غذایی مطرح می‌باشد، آزمایشات میکروبیولوژی مواد غذایی برای حضور این پاتوزن الزامی است (Fits et al., 1983). در حال حاضر، در آزمایشگاه‌های تشخیصی برای جستجوی بسیاری از میکروارگانیسم‌ها از روش‌های کشت میکروبی استفاده می‌شود. این روش در تشخیص آلودگی مواد غذایی بهسالمونلا علاوه بر مشکلات انجام آزمایش و عدم دقت در پاسخ‌های حاصله، نیازمند مدت زمان زیادی جهت حصول به نتیجه نهایی است. در روش کشت میکروبی برای تشخیص آلودگی میکروبی مواد غذایی به سالمونلاتایفی موریوم 4 الی 6 روز وقت لازم است که در مورد مواد غذایی از جمله شیر به عنوان یک ماده غذایی سریع الفساد، کارآمد نیست لذا به منظور افزایش حساسیت و کاهش زمان انجام آزمون از روش‌های دیگری مانند جستجوی ژن‌های  مربوط به این میکروارگانیسم‌ها از طریق روش PCR به عنوان روش جایگزین استفاده می‌شود (Rijpens, 1999; Cohen, 1996).

   با توجه به اهمیت آلودگی سالمونلا در مواد غذایی در بین مصرف کنندگان خصوصاً افراد مسن وکودکان، هدف از این مطالعه تعیین میزان شیوع سرووار سالمونلاتایفی موریوم در شیر خام گاو، گوسفند و بز عرضه شده در استان چهارمحال و بختیاری با استفاده از روش کشت و مولکولی بود.

 

مواد و روش‌ها

نمونه‌گیری

   در این مطالعه مجموعا 550 نمونه شیر خام گاو (200N=)، گوسفند (175N=) و بز (175N=) از دامداری‌های استان چهارمحال و بختیاری از مهر ماه تا اسفند ماه 1390 جمع‌آوری (هر نمونه مربوط به یک راس دام بوده است) و در مجاورت یخ و در شرایط استریل به آزمایشگاه میکربیولوژی دانشگاه آزاد اسلامی واحد شهرکرد منتقل گردید و حداکثر 6 ساعت پس از نمونه‌گیری از نظر حضور گونه‌های سالمونلا مورد آزمایش قرار گرفتند.

انجام آزمون‌های میکروبیولوژی

   برای این منظور 25 میلی‌لیتر از نمونه شیر به 225 میلی‌لیتر از محیط کشت Buffered Peptone Water (Merck) انتقال داده و در دمای 37 درجه به مدت 24 ساعت گرم‌خانه‌گذاری گردید. سپس 10 میلی‌لیتر از این سوسپانسیون به محیطSelenit Cystine Broth  (Merck) به عنوان محیط کشت غنی‌کننده منتقل گردید و به مدت 24 ساعت گرم‌خانه‌گذاری گردید. سپس یک لوپ از محیط غنی‌کننده در محیط (Merck) Agar Salmonella Shigella  کشت داده شد و 24 ساعت در دمای 37 درجه گرم‌خانه‌گذاری شد. پرگنه‌های شفاف و بی‌رنگ گاه با مرکز سیاه، رشد کرده در این محیط از نظر تخمیر قند لاکتوز، تولید اندول، MR، VP، سیترات و اوره آز مورد بررسی قرار گرفتند (Saroj et al., 2008).

تشخیص مولکولی سالمونلا تایفی موریوم

   به منظور تشخیص سرووار تایفی موریوم، DNA جدایه‌ها با استفاده از کیت استخراج DNA ساخت شرکت سیناژن و طبق دستورالعمل کارخانه استخراج گردید. DNA استخراج شده تا زمان انجام بررسی‌های مولکولی در فریزر در 20- درجه سلسیوس نگه‌داری شد. جهت تشخیص سالمونلا تایفی موریوم از پرایمرهایاختصاصی ژن STاستفاده گردید (Soumet et al., 1999). توالی‌های پرایمر مورد استفاده به شرح زیر می‌باشد.

ST11 F: 5’ GCCAACCATTGCTAAATTGGCGCA 3’

ST15 R: 5’ GGTAGAAATTCCCAGCGGGTACTGG 3’

 

   واکنش PCR در حجم نهایی 50 میکرو لیتر که شامل 2 میکرولیتر از DNA استخراج شده، 5 میکرولیترPCR buffer 10x،1 میکرولیتر dNTP، 2 میکرولیترMgcl2، 2 میکرولیتر پرایمرهای F و R، 3/0 میکرولیتر آنزیمTaq DNA Polymerase و آب مقطر)، با برنامه حرارتی 94 درجه به مدت 1 دقیقه، 35 سیکل تکراری 94 درجه 60 ثانیه، 56 درجه 30 ثانیه و 72 درجه 1 دقیقه و در نهایت 72 درجه 10 دقیقه انجام شد. مشاهده باند 429 جفت بازی نشان‌دهنده مثبت بودن آزمون PCR می‌باشد (Soumet, 1999). جهت ردیابی محصول مورد نظر، 20 میکرولیتر از محصول PCR روی ژل 5/1 درصد آگارز واجد اتیدیوم برماید در ولتاژ ثابت 80 ولت الکتروفورز و ژل حاصله با دستگاه تصویر بردار ژل (Uvitech U.K) قرائت گردید. مشاهده باند 429 جفت بازی نشان‌دهنده وجود ژن ST  می‌باشد.

 

 

یافته‌ها

   نتایج حاصل از این تحقیق در جدول 1 نشان داده شده است.

 

جدول 1-  تعداد و درصد موارد آلودگی به سالمونلا تایفی موریومدر نمونه‌های شیر خام استان چهارمحال و بختیاری

نمونه

تعداد نمونه

تعداد و درصد آلودگی

روش کشت

ر وش PCR

شیر گاو

200

14(54/2%)

6(09/1%)

شیر گوسفند

175

2(36/0%)

1(18/0%)

شیر بز

175

 4(72/0%)

2(36/0%)

مجموع

550

20(63/3%)

9(63/1%)

 

 

 

 

 

شکل 1- ژل حاصل از آزمون PCR در نمونه های مورد بررسی. ستون M : مارکر 100 bp ساخت شرکت فرمنتاز، ستون‌های 1، 2 نمونه‌های مثبت دارای باند 429 bp


بحث و نتیجه‌گیری

   باکتری سالمونلا یکی از معمول‌ترین پاتوژن‌های منتقله از راه مواد غذایی است که در سرتاسر جهان در انسان و حیوان ایجاد بیماری می‌کند. محصولات گوشتی آلوده، منبع اصلی سالمونلا معرفی شده‌اند و به گزارش سازمان بهداشت جهانی، سالیانه بالغ بر 16 تا 33 میلیون مورد بیمار و 500 تا  600  هزار مرگ ناشی از سالمونلا اتفاق می‌افتد که این مسئله به عنوان یک معضل بزرگ بهداشتی در کشورهای در حال توسعه از جمله کشور ما مطرح می‌باشد. مهم‌ترین سروتیپ جدا شده از انسان سالمونلا تایفی موریوم و انتریتیدیس است، بنابراین، کنترل میکروبی مواد غذایی اهمیت خاصی دارد (نصرتی و همکاران، 1391) .عوامل میکروبی مختلفی می‌توانند موجب فساد مواد غذایی و بروز بیماری شوند. این باکتری سبب ایجاد بیماری‌های دستگاه گوارشی می‌شود و اصلی‌ترین راه انتقال آن به وسیله آب، گوشت، تخم مرغ و غذاهای خام می‌باشد (رستگار و همکاران، 1387). سالمونلوز از بیماری‌های عفونی مشترک بین انسان و دام می‌باشد و افزایش شیوع آن بین انسان و حیوان، مخصوصاً در دهه‌های اخیر، اهمیت بیماری را دو چندان می‌نماید. برای جلوگیری از آلودگی سالمونلا، برنامه‌های نظارتی مورد نیاز است.

   نتایج حاصل از این تحقیق نشان داد که شیوع آلودگی به سالمونلا در نمونه‌های شیر خام شهرستان شهرکرد 63/3% می‌باشد. یکی از یافته‌های مهم مورد بررسی، آلودگی 63/1% درصدی سالمونلا تایفی موریوم در نمونه‌های شیر می‌باشد. از سال 1970 آلودگی به سالمونلا در گوشت گاو در ایران مورد توجه محققان قرار گرفت. که، فراوانی آلودگی با سالمونلا در گوشت گاو حدود 6/2% بود. در آن سال مرکز کنترل بیماری‌ها باکتری سالمونلاتایفیموریوم را به  عنوان یکی از عوامل بیماری‌های ناشی از مصرف مواد غذایی آلوده در گوشت گاو گزارش کرد (رستگار و همکاران، 1387).

در تحقیق انجام شده توسط کارنز و همکاران که به منظور جستجوی سالمونلا انتریکا بر روی نمونه‌های شیر خام صورت گرفت، از 854 نمونه مورد بررسی در 101 نمونه (8/11%) به روش Real time PCR به این باکتری آلوده تشخیص داده شد (Karns et al., 2005). مطالعات سایر محققان درصدهای متفاوتی از فراوانی این باکتری را در نمونه‌های شیر نشان می‌دهد. به عنوان مثال، استیل و همکاران در 1997 آلودگی به سالمونلا را در نمونه‌های شیر 17/0% گزارش کردند (Steele, 1997). موریندا و همکاران در 2002 شیوع گونه‌های سالمونلا را در شیر 24/2% گزارش کردند (Murinda et al., 2002). این نتایج با نتیجه به دست آمده از مطالعه حاضر هم‌خوانی نسبی را نشان می‌دهد. جایارو و هنینگ در 2001 شیوع سالمونلا را در نمونه‌های شیر 1/6% گزارش کردند (Jayarao et al., 2002).  روربچ و همکاران در 1992 شیوع سالمونلا در شیر را 9/8% گزارش کردند Rohrbach et al., 1992)). اختلاف در نتایج  ارائه شده می‌تواند به دلیل نوع روش جداسازی باشد. به علت حضور گونه سالمونلا در فضولات دامی، صنایع دامداری که گوشت و یا شیر تولید می‌کنند یک عامل تداوم حضور این پاتوژن انسانی در زنجیره غذایی می‌باشند. بنابراین می‌توان این گونه محصولات دامی را یک عامل بالقوه انتقال این بیماری در نظر گرفت (Daoust, 1994).

   در تحقیق حاضر شیوع سالمونلا در نمونه‌های شیر خام 63/3% برآورد گردید که با بعضی از نتایج مشابه و با بعضی از نتایج متفاوت می‌باشد. در تحقیق انجام شده توسط نصرتی و همکاران در 2012 به منظور بررسی شیوع سروتیپ‌های سالمونلاتایفیموریوم،تایفی و اینتریتیدیس در مواد غذایی در مرکز درمانی بیمارستان مفید آلودگی گوشت گاو بهسالمونلا 8/8 درصد برآورد گردید. در این تحقیق از گوشت مرغ باکتری سالمونلا جدا نگردید (نصرتی و همکاران، 1391).

   در تحقیق انجام شده توسط رستگار و همکاران در 1387، که به منظور آلودگی به سالمونلا بر روی نمونه‌های شیر پاستوریزه صورت گرفت، آلودگی به این باکتری در نمونه‌های شیر مشاهده نگردید (رستگار و همکاران، 1387). به این ترتیب با توجه به این که انتقال سالمونلا از طریق شیر و فرآورده‌های شیر امکان‌پذیر است، با پاستوریزاسیون شیر می‌توان احتمال انتقال را از بین برد.

   سالمونلا انتریکا سرووار تایفی موریوم و سالمونلا انتریکا سرووار انتریتیدیس از جمله سرووارهای بسیار مهم منتقله از راه مواد غذایی می‌باشند که در زمینه جداسازی این سرووارها تحقیقات متعددی صورت گرفته است. در بررسی انجام شده توسط جمشیدی و همکاران در مشهد آلودگی به سالمونلا تایفی موریوم در لاشه‌های مرغ 1.6% گزارش گردید (Jamshidi et al., 2002). 

   در تحقیق انجام شده توسط ناگوا و همکاران در 2012 در یونان آلودگی به گونه‌های سالمونلا در جوجه‌های گوشتی 4/1%، در گوشت مرغ فریز شده 4% و در افرادی که مسمومیت غذایی داشتند 10% گزارش گردید. تفاوت در میزان آلودگی به سالمونلا در مطالعات انجام شده توسط محققین مختلف می‌تواند به علت تفاوت در روش نمونه‌گیری باشد (Nagwa et al., 2012). 

   در تحقیق انجام شده توسط فرامرزی و همکاران در سال 2012 که به منظور آلودگی باکتریایی مواد غذایی در سطح عرضه مناطق غرب تهران صورت گرفت، آلودگی سالمونلایی محصولات لبنی (254 نمونه)، محصولات پروتیئنی (173) نمونه، شیرینی‌جات و آب میوه‌ها به ترتیب 8/1%، 85/0% و صفر درصد گزارش گردید. میزان آلودگی بستنی‌های سنتی به سالمونلا در این بررسی 54/11% و بستنی‌های صنعتی 7/2% گزارش گردید. از نظر آلودگی سالمونلایی از مجموع 642 نمونه مورد بررسی، در 4 مورد (26/0%) آلودگی سالمونلایی گزارش گردید (فرامرزی و همکاران، 1391). حال آن که در پژوهش انجام شده توسط سلطان دلال و همکاران در سال 2009، 8/47% از نمونه‌های مرغ و 8/28% از گوشت قرمز به سالمونلا آلوده بودند. در این بررسی سروتیپ غالب مربوط بهS.thompson   (9/54%) و  S.enteritidis (8/9%) بوده است (Soltan Dalal et al., 2009). فدایی و همکاران در 2008 نشان دادند 70% نمونه‌های شیر خام به اشرشیاکلی آلوده بودند (Fadaei et al., 2008). 

   عدم رعایت زنجیره سرما در حمل و نقل شیر، عدم شستشو و ضدعفونی کردن مناسب پستان دام به علت آلوده بودن پستان گاوها با مدفوع خود گاو، عدم رعایت بهداشت فردی کارگران گاوداری‌ها و انتقال باکتری از دست آن‌ها به شیر، عدم استفاده از آب سالم بهداشتی جهت شستشوی ظروف حمل و نگه‌داری شیر، پایین بودن سطح آگاهی کارگران گاوداری‌ها در زمینه بهداشت و سلامت شیر و پایین بودن سطح بهداشت دام‌ها از عوامل اصلی آلودگی شیر می‌باشد. نتایج حاصل از تحقیق حاضر نشان می‌دهد که درصد نسبتاً بالایی از نمونه‌های شیر خام گاو، گوسفند و بز به سالمونلا تایفی موریوم بعنوان یک میکروارگانیسم مشترک بین انسان و دام و شایع‌ترین عامل عفونت‌های سالمونلایی انسان آلوده می‌باشد و این امر ضرورت مراعات ضوابط بهداشتی بخصوص در مرحله شیردوشی و حمل و نقل و اجتناب از مصرف بطور مستقیم و یا در تولید فرآورده‌هایی مثل پنیر سنتی، بستنی سنتی و... واضح‌تر می‌سازد.

  • فدایی، عبدالمجید؛ جمشیدی، الهام و خیری، سلیمان (1387). مقایسه میزان آلودگی باکتریولوژیکی شیر خام و پاستوریزه در شهرکرد در سال 1385. مجله دانشگاه علوم پزشکی شهرکرد، 10(2): 44-37.
  • فرامرزی، طاهره؛ جنیدی جعفری، احمد؛ دهقانی، سمیه؛ میرزا بیگی، مریم؛ ناصح، منیره و رهبر آراسته، حمیرا (1391). بررسی آلودگی باکتریایی مواد غذایی در سطح عرضه مناطق غرب تهران. مجله دانشگاه علوم پزشکی فسا، 2(5): 217-212.
  • نصرتی، شیما؛ سبکبار، آذر؛ دزفولیان، مهروز؛ تبرایی، بهمن و فلاح، فاطمه (1391). بررسی شیوع سروتیپ‌های سالمونلا تایفی موریوم، تیفی و انتریتیدیس در مواد غذایی در مرکز درمانی بیمارستان مفید. مجله پژوهشی دانشکده دامپزشکی، 36(1): 48-43.
  • رستگار، حسین؛ قهرمانی، محمدحسین؛ حلاج نیشابوری، شیما؛ جلالی، مریم؛ انجرانی، صغری و خسروخاور، رویا (1387). ارزیابی، جداسازی و تشخیص سالمونلا تایفی موریوم در شیر با روش‌های متداول کشت و PCR. مجله علوم تغذیه و صنایع غذایی ایران 3(3): 52-45.
  • شاپوری، رضا؛ رهنما، مهدی و اقبال‌زاده، شبنم (1388). بررسی شیوع سروتایپ‌های سالمونلا در گوشت مرغ و تخم‌مرغ و تعیین حساسیت آنتی بیوتیکی آن‌ها در شهر زنجان. فصلنامه علوم زیستی دانشگاه آزاد اسلامی واحد زنجان، 2(3): 71-63.  
 

  • Bezanson, G.S., Khakhria, R., Duck, D. and Lior, H. (1985). Molecular analysis confirms food source simultaneous involvement of two distinct of but related subgroups of Salmonella typhymurium bacteriophage type 10 in major interprovincial Salmonella outbreak. Applied and Environmental Microbiology, 50(5): 1279-1284.
  • Cohen, H.J., Mechanda, S.M. and Lin, W. (1996). PCR amplification of the fimA gene sequence of Salmonella typhimurium, a specific method for detection of Salmonella spp. Applied and Environmental Microbiology, 62(12): 4303-8.
  • Daoust, J.Y. (1994). Salmonella and the international food trade. International Journal of food Microbiology, 24(1-2): 11-31.
  • de Freitas, C.G., Santana, A.P., da Silva, P.H., Gonçalves, V.S., Barros Mde, A., Torres, FA., et al. (2010). PCR multiplex for detection of Salmonella Enteritidis, Typhi and Typhimurium and occurrence in poultry meat. International Journal of Food Microbiology, 139: 15-22.
  • Espie, E. and Vaillant, V. (2005). International outbreak of Salmonella Stourbridge infection, April- July 2005: results of epidemiological, food and veterinary investigations in France. Euro Surveillance. 10(8): E050811 3.    
  • Fitts, R., Diamond, M., Hamilton, C. and Neri, M. (1983). DNA-DNA hybridization assay for detection of Salmonella spp. In foods. Applied and Environmental Microbiology, 46: 1146- 51.
  • Foley, S.L. and Lynne, A.M. (2008). Food animal-associated Salmonella challenges: pathogenicity and antimicrobial resistance. Journal of animal science, 86: 173-187.
  • Hennessy, T.W., Hedberg, C.W., Slutsker, L., Besser-Wiek, J.M., Moen, M.E., Feldman, J., et al. (1996). The Investigation Team. The New England Journal of Medicine, 334: 1281-1286.
  • Jamshidi, A., Bassami, M.R. and Afshari-Nic, S. (2009). Identification of Salmonella spp. and Salmonella typhimurium by a multiplex PCR-based assay from poultry carcasses in Mashhad- Iran. International Journal of Veterinary Research, 3(1) 43-48.
  • Jayarao, B.M. and Henning, D.R. (2001). Prevalence of foodborne pathogens in bulk tank milk. Journal of Dairy Science, 84: 2157–2162.
  • Karns, J.S., Van Kessel, J.S., McCluskey, B.J. and Perdue, M.L. (2005). Prevalence of Salmonella enterica in Bulk Tank Milk from US Dairies as Determined by Polymerase Chain Reaction. Journal of Dairy Science, 88: 3475-3479.
  • Murinda, S.E., Nguyen, L.T., Ivey, S.J., Gillespie, B.E., Almeida, R.A., Draughon, F.A., et al. (2002). Molecular characterization of Salmonella spp. isolated from bulk tank milk and cull dairy cow fecal samples. Journal of food Protection, 65:1100-1105.
  • Nagwa, S.R., Nashwa, O., Khalifa, Mervat, E.I.R. and Jehan S.A.A. (2012). Epidemiological and Molecular Studies of SalmonellaIsolates from Chicken, Chicken Meat and Human in Toukh, Egypt. Global Veterinaria, 8(2): 128-132.
  •  Yin Ngan, G.J., Li Mei, N.g., Raymond, T.P.L. and Jeanette, W.P.T. (2010). Development of a novel multiplex PCR for the detection and differentiation of Salmonella enterica serovars typhi and paratyphi A. Research in Microbiology, 161: 243-248.
  • Rijpens, N., Herman, L., Vereecken, F., Jannes, G., De Smedt, J. and De Zutter, L. (1999). Rapid detection of stressed Salmonella spp.a In: Dairy and egg products using immunomagnetic separation and PCR. International Journal of Food Microbiology, 46: 37- 44.
  • Rohrbach, B.W., Draughon, F.A., Davidson, P.M. and Oliver, S.P. (1992). Prevalence of Listeria monocytogenes, Campylobacter jejuni, Yersinia enterocolitica, and Salmonellain bulk tank milk: Risk factors and risk of human exposure. Journal of food Protection, 55: 93-97.
  • Saroj, S.D., Shashidhar, R., Karani, M. and Bandekar, J.R. (2008). Rapid, sensitive, and validated method for detection of Salmonella in food by an enrichment broth culture- nested PCR combination assay. Molecular and Cellular Probes (MCP), 22: 201-206.
  • Soltan Dalal, M.M., Taremi, M., Latif Gachkar, L., Modarressi, S.h., Sanaei, M., Bakhtiari, R., Sharifi Yazdi, M.K. and Zali, M.R. (2009). Characterization of antibiotic resistant patterns of Salmonellaserotypes isolated from beef and chicken samples in Tehran. Jundishapour Journal of Microbiology, 2(4): 124- 131.
  • Solhan, S., Chan, P.P., Kurupatham, L., Foong, B.H.PL., James, L., Phua, L., Tan, A.L., Koh, D.and Goh, K.T. (2011). An outbreak of gastroenteritis caused by Salmonella enterica serotype enteritidis traced to cream cakes, West Pac Survey Research, 2: 23-30.
  • Soumet, C., Ermel, G., Rose, V., Rose, N., Drouin, P., Salvat, G. and Colin, P. (1999).  Identification by a multiplex PCR based assay of Salmonella Typhimurium and Salmonella enteritidis strains from environmental swabs of poultry houses. Letters in applied microbiology, 29(1): 1-6
  • Steele, M.L., McNab, W.B., Poppe, C., Griffiths, M.W., Chen, S., Degrandis, S.A., Fruhner, L.C., Larkin, C.A., Lunch, J.A. and Odumeru, J.A. (1997). Survey of Ontario bulk tank milk for foodborne pathogens. Journal of Food Protection, 60: 1341–1346.