جداسازی و شناسایی استافیلوکوکوس اورئوس از فرآورده‌های گوشتی و بررسی حضور ژن مولد انتروتوکسین A

نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، واحد تنکابن، گروه میکروبیولوژی، دانش آموخته کارشناسی ارشد میکروبیولوژی، تنکابن، ایران

2 استادیار، دانشگاه آزاد اسلامی، واحد تنکابن، گروه میکروبیولوژی، تنکابن، ایران

چکیده

   استافیلوکوکوس اورئوس، یکی از مهمترین عوامل ایجادکننده بیماری‌های منتقله از راه مواد غذایی می‌باشد.هدف از انجام این مطالعه، تعیین میزان فراوانی استافیلوکوکوس اورئوس در فرآورده‌های گوشتی و شناسایی ژن تولیدکننده انتروتوکسینSEA می‌باشد. پس از جمع‌آوری 150 نمونه گوشتی، نمونه‌ها با استفاده از تکنیک استاندارد کشت و تست‌های فنوتایپینگ استاندارد از نظر وجود استافیلوکوکوس اورئوس مورد بررسی قرار گرفتند. پس از استخراج DNA، آزمون PCR با استفاده از پرایمرهای اختصاصی جهت شناسایی ژن sea صورت گرفت. بر اساس نتایج به دست آمده، در 19 مورد نمونه (6/12%) استافیلوکوکوس اورئوس جدا گردید. بیشترین میزان آلودگی به ترتیب، مربوط به ماهی دودی (30%)، کباب لقمه (6/16%)، انواع کالباس و ژامبون (3/13%) و شنسل مرغ (3/3%) بود. در انواع سوسیس هیچ موردی از آلودگی به استافیلوکوکوس اورئوس مشاهده نگردید. بررسی‌های آماری نشان داد که در مقایسه میزان فراوانی استافیلوکوکوس اورئوس و نوع فرآورده­های گوشتی اختلاف آماری معنی‌دار وجود دارد (05/0 >p). همچنین با انجام تکنیک PCR مشخص گردید که ژن sea در هیچیک از جدایه‌ها وجود ندارد. در این مطالعه میزان آلودگی مواد غذایی مورد بررسی به  استافیلوکوکوس اورئوس نسبتاً قابل ملاحظه می‌باشد.

کلیدواژه‌ها


عنوان مقاله [English]

Isolation, identification and the presence of enterotoxin A gene in Staphylococcus aureus from meat products

نویسندگان [English]

  • M Sepidarkish 1
  • M Ghane 2
1 Ms.c Graduate of Microbiology, Department of Microbiology, Tonekabon Branch, Islamic Azad University, Tonekabon, Iran
2 Assistant Professor, Department of Microbiology, Tonekabon Branch, Islamic Azad University, Tonekabon, Iran.
چکیده [English]

   Staphylococcus aureus is one of the main causes of food-born illnesses. The aim of this study was to determine the prevalence of S. aureus in meat products and to detect the presence of S. aureus enterotoxin A (SEA) gene. Totally 150 meat products were collected and analyzed using standard culture techniques to detect S. aureus. PCR assay by specific primers was performed on the isolates to identify SEA gene. According to the results, 19 (12.6%) of the samples were found positive for S. aureus. Highest prevalence rate was determined in smoked fish (30%), followed by fried morsels (16.6%), Salami and Ham (13.3%), and Shensel chicken (3.3%). S. aureus was not observed in any of Sausage samples. Statistical analysis showed that there is statistically significance association between the prevalence of S. aureus and  meat products. Moreover, results did not show SEA gene in any of the isolates. This study concluded a remarkable occurrence of S. aureus in meat products.
 

کلیدواژه‌ها [English]

  • Staphylococcus aureus
  • SEA enterotoxin
  • PCR technique
  • Meat products

مقدمه

   بیماری‌های منتقله از راه غذا معضل اساسی سلامت و بهداشت عمومی محسوب می‌شوند؛ به طوریکه سالانه با صرف هزینه‌های چند میلیارد دلاری، میلیون‌ها نفر از جمعیت جهان به آن مبتلا، بخشی نیز دچار مرگ شده و یا عامل بستری شدن در بیمارستان‌ها می‌گردد .استافیلوکوکوساورئوس به عنوان دومین علت مهم این بیماری‌ها محسوب می‌شود .(Eshraghi et al., 2009) مسمومیت غذایی این باکتری که به علت حضور سویه‌های انتروتوکسیژنیک آن در غذاها می‌باشد، برخلاف مسیر آرام خود خسارات اقتصادی قابل ملاحظه‌ای ایجاد می‌نماید .(Eshraghi et al., 2009) تخمین زده می‌شود که تقریباً 25% از کل گونه‌های جدا شده، انتروتوکسیژنیک هستند((Giannatale et al., 2011. انتروتوکسین‌های استافیلوکوکوس اورئوس(SE ها) عوامل ایجادکننده مسمومیت غذایی هستند و شامل گروهی از پروتئین‌های کروی با زنجیره ساده به وزن مولکولی 28000 تا 35000 می‌باشند .(Adibfar, 1383)آن‌ها اگزوتوکسین‌های معدی- روده‌ای قوی می‌باشند که در طول فاز لگاریتمی رشد یا در طول گذر به فاز سکون سنتز می‌گردند  (Argudín et al., 2010).

انتروتوکسین‌ها ابر آنتی‌ژن‌هایی هستند، که به مولکول‌های MHC کلاس II پیوند یافته و سبب تحریک سلول‌های T می‌شوند (Jawetz et al., 1387). از آنجا که این انتروتوکسین‏ها تحت شرایط دمایی، pH پایین و آنزیم‏های پروتئولیتیک مقاوم می‏باشند، طی فرایند هضم در معده فعال باقی می‏مانند ((Argudín et al., 2010. هفت کلاس اصلی آنتی‌ژنی از انواع انتروتوکسین‌ها شامل:SEA ،SEB ، SEC1، SEC2،SEC3، SED وSEE  تاکنون شناسایی شده است (Rahimi et al., 2012). ژن‏های کدکننده SEها پشتبان‏های ژنتیکی متفاوتی از قبیل sea (پروفاژ)، seb(کروموزوم، پلاسمید، ترانسپوزون)،  sec1(پلاسمید)، sec2,3(جزایر بیماری‌زایی)، sed(پلاسمید)، see(فاژ ناقص) داشته که غالبا عناصر ژنتیکی متحرک می‏باشند (Loir et al., 2003). SEA رایج‌ترین توکسینی است، که در شیوع مسمومیت‌های غذایی استافیلوکوکی وجود دارد. مقدار SEA لازم برای ایجاد مسمومیت متغیر می‌باشد، به‌طوری‌که مقدار لازم برای ایجاد عمل استفراغ 20 تا 2/0 میکروگرم است (Pepe et al., 2006). با شناخت میزان شیوع این باکتری در مواد غذایی می‌توان اولاً منبع عفونت را شناسایی نمود و سپس با کمک گرفتن از روش‌های استاندارد، آلودگی این قبیل مواد غذایی را به حداقل رساند. هدف از انجام این مطالعه، تعیین میزان فراوانی استافیلوکوکوس اورئوس در فرآورده‌های گوشتی و شناسایی ژن تولیدکننده انتروتوکسینSEA  می‌باشد.

 

مواد و روش‌ها

آماده‌سازی نمونه‌های آزمایشی: 150 نمونه از فرآورده‌های گوشتی کارخانجات گوناگون شامل 30 نمونه سوسیس، 30 نمونه کالباس و ژامبون، 30 نمونه کباب لقمه خام، 30 نمونه شنسل مرغ نیمه پخته و 30 نمونه از انواع ماهی دودی جمع‌آوری و به آزمایشگاه میکروب‌شناسی انتقال یافت. نمونه‌ها در زیر هود با استفاده از اسکالپل استریل قطعه قطعه شده و به منظور غربالگری به محیط کشت نوترینت براث (مرک-آلمان) حاوی 5/7 درصد نمک انتقال یافتند. گرمخانه‌گذاری به مدت 48 ساعت و در دمای 37 درجه سلسیوس انجام شد. سپس باکتری‌ها در محیط برد پارکر آگار )مرک-آلمان(  با زرده تخم‌مرغ و تلوریت پتاسیم کشت شدند. کلنی‌های استافیلوکوکوس اورئوس که به رنگ سیاه بر روی محیط رشد کرده بودندبرای تأیید نهایی مورد آزمایشات رنگ‌آمیزی گرم، تست کاتالاز، تست کواگولاز، تست DNase و تخمیر مانیتول قرار گرفتند.

استخراج DNA: استخراج DNA تمامی سویه‌های جدا شده به کمک لیزوزیم و کیت استخراج (کیاژن) انجام شد. تأیید استخراج DNA با استفاده از جذب نوری در طول موج 280-260 نانومتر با استفاده از دستگاه اسپکتروفتومتر صورت پذیرفت.

واکنش PCR برای شناسایی ژن sea: واکنش زنجیره‌ای پلیمراز جهت یافتن ژن seaبا استفاده از پرایمرهای اختصاصی (تک کپنهاگن-دانمارک) صورت گرفت. (جدول1). واکنش زنجیره‌ای پلیمراز در حجم 20 میکرولیتر شامل مستر میکس PCR (کیاژن) 10 میکرولیتر، پرایمر فوروارد 1 میکرولیتر، پرایمر ریورس 1 میکرولیتر، آب مقطر استریل 3 میکرولیتر و DNA نمونه 5 میکرولیتر انجام گرفت. جهت آغاز فرایند پلیمریزاسیون، دستگاه ترمال سیکل به مدت 5 دقیقه بر روی دمای 95 درجه سلسیوس جهت دناتوراسیون اولیه تنظیم گردید. متعاقب آن 40 سیکل PCR به صورت 95 درجه سلسیوس به مدت 1 دقیقه، 51 درجه سلسیوس به مدت 1 دقیقه و 72 درجه سلسیوس به مدت 1 دقیقه اجرا گردید. در نهایت به مدت 5 دقیقه عمل طویل سازی نهایی در 72 درجه سلسیوس اجرا گردید (جدول2).

 

 

جدول 1- توالی پرایمرها در ژن انتروتوکسین

ژن

پرایمر

(5’-3’) سکانس اولیگونوکلئوتیدی

سایز (bp)

رفرنس

Sea

sea-1

TTGGAAACGGTTAAAACGAA

120

Giannatale et al., 2011

sea-2

GAACCTTCCCATCAAAAACA

 

جدول 2- شرایط PCR برای تکثیر ژن sea

1 سیکل

تقلیب اولیه

95 درجه سلسیوس و 5 دقیقه

40 سیکل

تقلیب

95 درجه سلسیوس و 1 دقیقه

اتصال پرایمرها

51 درجه سلسیوس و 1 دقیقه

طویل‌سازی

72 درجه سلسیوس و 1 دقیقه

1 سیکل

طویل‌سازی نهایی

72 درجه سلسیوس و 5 دقیقه

 


آنالیز آماری

   از آزمون کای دو برای بررسی مقایسه بین میزان فراوانی استافیلوکوکوس اورئوس و نوع فرآورده­های گوشتی، استفاده گردید.

 

یافته‌ها

   در این مطالعه 150 نوع فرآورده گوشتی از نظر آلودگی به استافیلوکوکوس اورئوس مورد بررسی قرار گرفتند. در مجموع در 19 مورد (6/12%) استافیلوکوکوس اورئوس جدا گردید. بیشترین میزان آلودگی به ترتیب در ماهی دودی با 9 مورد (30%)، کباب لقمه با 5 مورد (6/16%)، انواع کالباس و ژامبون با 4 مورد (3/13%) و شنسل مرغ با 1 مورد (3/3%) بود. لازم به ذکر است که درصد فراوانی استافیلوکوکوس اورئوس در سوسیس برابر با صفر بوده است.

   مقدار برای آزمون استقلال کای­دو 004/0 و کوچکتر از 05/0 بود که نشانه تایید وجود رابطه میان میزان فراوانی استافیلوکوکوس اورئوس و نوع فرآورده‌های گوشتی در سطح اطمینان 95% می­باشد.

   نتایج PCR برای ژن sea نشان داد پس از انتقال محصولات PCR بر روی ژل آگاروز 5/1% و انجام الکتروفورز، در هیچ یک از نمونه ها ژن seaشناسایی نگردید.

 

 

 

 

 

 


بحث و نتیجه‌گیری

   در این مطالعه که بر روی فرآورده‌های گوشتی مختلف صورت پذیرفت، 150 ماده ی غذایی مورد بررسی قرار گرفت و در 19 مورد (6/12%) استافیلوکوکوس اورئوس جدا گردید. بیشترین میزان آلودگی به ترتیب مربوط به ماهی دودی با 9 موردآلودگی، کباب لقمه با 5 مورد، انواع کالباس و ژامبون با 4 مورد، شنسل مرغ با 1 مورد آلودگی بود و در انواع سوسیس هیچ موردی از آلودگی به استافیلوکوکوس اورئوس مشاهده نگردید. مطالعه حاضر اولین مطالعه انجام شده بر روی شنسل مرغ می‌باشد که شیوع استافیلوکوکوس اورئوس را در این محصول 3/3% نشان می‌دهد. همچنین مطالعات اندکی بر روی فرآورده‌های گوشتی ای نظیر سوسیس و کالباس صورت پذیرفته است. به نظر می‌رسد بالا بودن میزان آلودگی در ماهی دودی به دلیل تهیه ی غیر بهداشتی آن توسط افراد محلی باشد. و علت این که در سوسیس‌ها هیچ موردی از آلودگی دیده نشد، این است که این فرآورده در شرایط بهداشتی و در بسته‌بندی‌های مناسب در کارخانجات تهیه می‌گردد. و بسته‌بندی مناسب آن باعث می‌شود که کمتر در معرض آلودگی قرار گیرد. در مطالعه‌ای که بر روی شناسایی و میزان فراوانی استافیلوکوکوس اورئوسهای جدا شده از حیوانات و سبزیجات در کره‌جنوبی صورت گرفته، استافیلوکوکوس اورئوس با شیوع 36% از فرآورده‌های گوشتی جدا گردیده است (Moon et al., 2007).

  در مطالعه‌ای که توسط جیاناتال Giannatale و همکاران (2011) بر روی جداسازی و شناسایی استافیلوکوکوساورئوساز غذاهای مصرفی انسان در ایتالیا صورت گرفته؛ آن‌ها توانستند استافیلوکوکوس اورئوس را با شیوع 3/19% از فرآورده‌های گوشتی جداسازی نمایند، که این مطالعات با تحقیق حاضر هم‌خوانی دارند. میزان آلودگی در کشورهای گوناگون متفاوت است که باعث ایجاد شیوع‌های متفاوتی می‌گردد. همچنین در این مطالعه با انجام تکنیک PCR مشخص گردید که ژن sea در هیچ یک از جدایه‌ها وجود ندارد. در مطالعه‌ای که بر روی بررسی میزان فراوانی استافیلوکوکوس اورئوس و انتروتوکسین A استافیلوکوکی در جوجه‌های سوخاری در ایتالیا انجام گرفته؛ آن‌ها از مجموع 20 جوجه سوخاری صنعتی نتوانستند هیچ ژن sea ای را شناسایی کنند (Pepe et al., 2006).

   در مطالعه‌ای که بر روی میزان شیوع ژن انتروتوکسین‌های معمول در استافیلوکوکوس اورئوس‌های جدا شده از شیر گاومیش‌های شهرستان تبریز به روش Multiplex PCR انجام گرفته، نتایج حاصل نشان داده که از 75 نمونه باکتریایی یک جدایه واجد انتروتوکسین‌های SEB و SEC، سه جدایه واجد انتروتوکسین SEC بودند و ژن مربوط به انتروتوکسین A در هیچ کدام از جدایه‌ها شناسایی نگردیده است (Esnaashari et al., 2012) که این مطالعات با تحقیق صورت گرفته همسو می‌باشند.

    در یک مطالعه در ایتالیا که توسط فیرینو و همکاران در سال 2003 صورت گرفت، ثابت شد که 2/45% از گونه‌های جدا شده از محصولات گوشتی انتروتوکسین تولید می‌کنند. که فراوانی آن‌ها به ترتیب شامل انتروتوکسین C5/51%، انتروتوکسین A 3/30% و با گستردگی کمتر SEB و SED قرار داشتند ((Giannatale et al., 2011.

   در یک مطالعه که به وسیله نورمنو و همکاران (2005) 1/23% از محصولات گوشتی تازه و آماده بازار در ایتالیا به وسیله استافیلوکوکوس اورئوس‌های انتروتوکسیژنیک آلوده بودند. که قسمت عمده  استافیلوکوکوس اورئوسهای انتروتوکسیژنیک جدا شده SEA و SEC تولید می‌کرده‌اند. در تحقیقی دیگر که توسط پلیسر و همکاران (2009) بر روی شیوع  استافیلوکوکوس اورئوس و شناسایی ژن‌های انتروتوکسین در محصولات گوشتی صورت گرفته؛ آن‌ها توانستند ثابت کنند که از مجموع 102 نمونه گوشت آلوده به استافیلوکوکوس اورئوس، 91 مورد ژن femA، 10 مورد ژن sea، 12 مورد ژن sedو 4 مورد ژن seeرا دارا می‌باشند. در تحقیقی که بر روی پروفایل‌های ژن انتروتوکسین استافیلوکوکوس اورئوس و دیگر استافیلوکوک‌ها جدا شده از غذاهای گوناگون صورت گرفت؛ از مجموع 70 نمونه استافیلوکوکوس اورئوس جدا شده در 2 نمونه گوشت مرغ (9/2%) ژن seaشناسایی شد (Gencay et al., 2010). که این مطالعات با تحقیق حاضر همسو نمی‌باشند. بدین جهت عفونت‌های منتقله از راه غذا و مسمومیت‌های غذایی، نگرانی بسیار مهمی برای دولت‌ها و صاحبان صنایع غذایی در چند دهه اخیر بوده است. در هر حال میزان آلودگی مواد غذایی به استافیلوکوکوس اورئوس در کشور ما نسبتاً قابل ملاحظه می‌باشد ((Eshraghi et al., 2009. از طرفی افراد در معرض خطر مانند کودکان، افراد مسن و موارد نقص ایمنی در ایران جمعیت نسبتاً زیادی را به خود اختصاص می‌دهند. این موضوع با در نظر گرفتن میزان بالای کلونیزاسیون این باکتری در افراد سالم که گاه تا 60-50% در ناحیه نازوفارنکس و 30-5% در پوست و مو می‌رسد، به خصوص از ناحیه مسئولین تهیه غذاها پر رنگتر می‌شود (Eshraghi et al., 2009). همچنین آگاهی جامعه از میزان شیوع باکتری و انتروتوکسین‌های تولید شده توسط آن از ابتلا افراد به بیمارهای گوارشی می‌کاهد.

  • ادیب فر، پرویز (1383). میکروب‌شناسی پزشکی. انتشارات نور دانش، صفحات 74-63.
  • اشراقی، سعید؛ صالحی پور، زهره؛ پورمند، محمدرضا؛ رحیمی دروشانی، عباس؛ زهرا صالحی، محمدتقی؛ آقامیری، سولماز؛ همکاران (1388). بررسی توزیع فراوانی ژن tst با ژن های ,entC ,ent A ent A/C در ایزوله‌های استافیلوکوکوس اورئوس جدا شده از مواد غذایی مختلف. مجله دانشکده پزشکی دانشگاه علوم پزشکی تهران، دوره 67، شماره 7، صفحات 476-470.
  • اثنی عشری، مهرداد؛ شایق، جلال و عمران نصرالهی، آیت الله (1391). مطالعه میزان شیوع ژن‌های انتروتوکسین‌های معمول استافیلوکوکوس اورئوس های جدا شده از شیر گاومیش‌های استان تبریز به روش Multiplex PCR. مجله بهداشت مواد غذایی تبریز، دوره 2، شماره 2، صفحات 68-61.
  • جاوتز، ارنست؛ ملنیک، جوزف لویس؛ آدلبرگ، ادوارد؛ بروکس، ژئو؛ بوتل، ژانت و استفان، مورس (1387). میکروب‌شناسی پزشکی. ترجمه: رحیمی، محمد کریم و اطهری، عمید، انتشارات آییژ، تهران، ایران، صفحه 269.
 

  • Argudín, M.A., Mendoza, M.C. and Rodicio, M.R. (2010). Food Poisoning and Staphylococcus aureus Entrotoxins.Toxins, 2(7): 1751-1773.
  • Gencay, Y.E., Ayaz, N.D. and Dogru, A.K. (2010). Enterotoxin Gene Profiles of Staphylococcus aureus and Other Staphylococcal Isolates from Various Foods and Food Ingredients. Journal of Faculty of Veterinary Medicine Erciyes University, 7(2): 75-80. 
  • Giannatale, E.D., Prencipe, V., Tonelli, A. and Marfoglia, C. (2011). Characterization of Staphylococcus aureus trains isolated from food human consumption. Veterinaria Italiana, 47(2): 165-173.
  • Loir, Y.L., Baron, F. and Guatier, M. (2003). Staphyloococcus aureus and food poisoning. Genetics and Molecular Research, 2(1): 63-76.
  • Moon, J.S., Lee, A.R., Jaw, S.H., Kang, H.M., Joo, Y.S., Park, Y.H., et al. (2007). Comparison of antibiogram, staphylococcal enterotoxin productivity, and coagulase genotypes among Staphylococcus aureus isolated from animal and vegetable sources in Korea. Journal of Food Protection, 70(11): 2541-8.
  • Oh, S.K., Lee, N., Cho, Y.S., Shin, D.B., Choi, S.Y. and Koo, M. (2007). Occurrence of toxigenic Staphylococcus aureus in ready-to-eat food in Korea. Journal of Food Protection,70(5): 1153-8.
  • Pelisser, M.R., Klein, C.S., Ascoli, K.R., Zotti, T.R. and Arisi, A.C.M. (2009). Ocurrence of Staphylococcus aureus and multiplex PCR detection of classic enterotoxin genes in cheese and meat products. Brazilian Journal of Microbiology, 40(1): 145-148.
  • Pepe, O., Blaiotta, G., Bucci, F., Anastasio, M., Aponte, M. and Villani, F. (2006). Staphylococcus aureus and Staphylococcal Enterotoxin A in Breaded Chicken Products: Detection and Behavior during the Cooking Process. AppliedandEnvironmental Microbiology, 72(11): 7057–7062. 
  • Rahimi, E., Mommtaz, H., Shakerian, A. and Kavyani, H.R. (2012). The detection of classical  enterotoxins of Staphylococcus aureus in raw cow milk using the ELISA method. Turkish Journal of Veterinary and Animal Sciences, 36(3): 319-322.