مطالعه میزان شیوع گونه‌های ویبریو و فراوانی ژن‌های حدت در ویبریو پاراهمولیتیکوسهای جداسازی شده از میگوهای تازه و نمک سود شده در بندر گناوه

نوع مقاله: مقاله پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، واحد شهرکرد، باشگاه پژوهشگران جوان و نخبگان، شهرکرد، ایران.

2 دانشگاه آزاد اسلامی، واحد شهرکرد، دانشیار گروه بهداشت مواد غذایی، دانشکده دامپزشکی، شهرکرد، ایران

چکیده

   گونه‌های ویبریو پاتوژن‌های منتقله از طریق غذاهای دریایی هستند که مسئول موارد بسیاری از گاستروآنتریت‌ها می‌باشند. مطالعه حاضر به منظور تعیین میزان شیوع گونه‌های ویبریو و فراوانی ژن‌های حدت tdh، tlh و trh در ویبریو پاراهمولیتیکوسهای جداسازی شده از نمونه‌های میگو تازه و نمک سود شده، انجام پذیرفت. در کل 60 نمونه میگوی تازه و نمک سود شده از بندر گناوه جمع‌آوری شد. کشت میکروبی به منظور جداسازی گونه‌های ویبریو انجام پذیرفت. همچنین حضور ویبریو پاراهمولیتیکوس، ویبریو کلرا، ویبریو ولنیفیکوس و ویبریو هاروی و ژن‌های حدت ویبریو پاراهمولیتیکوس، با استفاده از تکنیک PCR، مورد بررسی قرار گرفتند. نتایج نشان داد که 20 درصد از نمونه‌های میگو تازه و 33/23 درصد از نمونه‌های میگو نمک سود شده از نظر حضور گونه‌های ویبریو مثبت بودند. ویبریو ولنیفیکوس بیشترین میزان شیوع (33/8 درصد) را نشان داد، در حالی که ویبریو کلرا کمترین میزان شیوع (66/1درصد) را در نمونه‌های مورد بررسی داشت. از کل 4 ویبریو پاراهمولیتیکوس تشخیص داده شده، همه آنها ژن tlh را داشتند (100 درصد). فراوانی ژن‌های tdh و trh در ویبریو پاراهمولیتیکوس‌های جداسازی شده به ترتیب 50 درصد و 25 درصد بوده است. شیوع بالای گونه‌های ویبریو و خصوصا ویبریو پاراهمولیتیکوس حدت‌دار در نمونه‌ها تاییدکننده عدم رعایت بهداشت در مراکز تهیه و توزیع میگو و فرآورده‌های آن است.

کلیدواژه‌ها


عنوان مقاله [English]

Prevalence study of Vibrio species and frequency of the virulence genes of Vibrio parahaemolyticus isolated from fresh and salted shrimps in Genaveh seaport

نویسندگان [English]

  • S Hosseini 1
  • F Safarpoor Dehkordi 1
  • E Rahimi 2
  • A Shakerian 2
1 Young Researchers and Elites Club, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
2 Associated Professor of Food Hygiene, College of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
چکیده [English]

Vibrio species are important seafood-borne pathogens that are responsible for 50-70% of gasteroenteritis. The present study was carried out in order to determine the prevalence of Vibrio species and the distribution of tdh, tlh and trh virulence genes in Vibrio parahaemolyticus isolated from fresh and salted shrimp samples. Totally, 60 fresh and salted shrimp samples were collected from the Genaveh seaport. Microbial culture was used to isolate Vibrio species. In addition, the presences of Vibrio parahaemolyticus, Vibrio cholera, Vibrio vulnificus and Vibrio harveyi and the virulence genes of V. parahaemolyticus were studied using the PCR method. Results showed that 20% of fresh and 23.33% of salted shrimp samples were positive for Vibrio species. In studied samples, V. vulnificus had the highest prevalence rate (8.33%), while V. cholera had the lowest prevalence rate (1.66%). From a total of 4 detected V. parahaemolyticus, all of them had tlh gene (100%). The distribution of tdh and trh genes in isolated V. parahaemolyticus strains were 50% and 25%, respectively. High prevalence of Vibrio species and especially virulent V. parahaemolyticus in samples confirmed the lack of hygienic condition in the production and distribution centers of shrimp. 

کلیدواژه‌ها [English]

  • vibrio species
  • Vibrio parahaemolyticus
  • Fresh shrimp
  • Salted shrimp

مقدمه

   یکی از اقلام غذایی که می‌تواند دربرگیرنده اکثر نیازهای بدن از جمله پروتئین، اسیدهای چرب ضروری مانند امگا-3 و مواد معدنی مانند ید، فسفر و آهن باشد، آبزیان هستند (Gerooz roy, 2001; Shishe chian, 2003). امروزه با توجه به افزایش مصرف فرآورده‌های دریایی و خصوصاً میگو در ایران، بهداشت و سلامت این منابع غذایی بیش از پیش باید مورد توجه قرار گیرد. با توجه به این که فلور باکتریایی طبیعی موجود در آب دریاها می‌تواند به‌عنوان فلور طبیعی موجود در مواد غذایی دریایی مطرح باشد، اهمیت بهداشتی فرآورده‌های دریایی به مراتب بیشتر از آن است که به‌نظر می‌آید (Hill, 1996). پوشش لزج مانند سطح بدن آبزیان، محل مناسبی را برای رشد باکتری‌هایی مانند گونه‌های ویبریو، فراهم می‌کند (Razavilar, 1996).

   گزارش‌های متعددی از وقوع ویبریوزیس در اثر مصرف فرآورده‌های دریایی آلوده به گونه‌های باکتری ویبریو (Vibrio) از نقاط مختلف جهان مانند چین، ژاپن، تایوان، ایران و آمریکا، در دسترس می‌باشد (Kaysner and DePaola, 2001; Su and Liu, 2007; Rahbar et al., 2007). گزارش پیشین در سال 2011  نشان می‌دهد که ویبریوزیس ناشی از گونه‌های ویبریو مسئول 80000 مورد بیماری در آمریکا  بوده که 500 مورد آن منجر به بستری شدن در بیمارستان‌ها و 100 مورد منجر به مرگ شده است (Scallan et al., 2011).

   ویبریوها باکتری‌هایی میله‌ای شکل، مستقیم یا خمیده، گرم منفی، غیرهاگ‌زا، بدون کپسول، بدون اسپور و متحرک هستند (Razavilar, 1998). اغلب گونه‌های ویبریو نمک‌دوست بوده و در آب‌های شور زندگی می‌کنند. این باکتری‌ها در حضور 4-2 درصد نمک به خوبی رشد نموده و تا غلظت 8 درصد نمک را نیز تحمل می‌کنند. گونه‌های مهم این جنس شامل ویبریو پاراهمولیتیکوس (Vibrio parahaemolyticusویبریو کلرا (Vibrio choleraویبریوهاروی (Vibrio harvey) و ویبریو ولنیفیکوس (Vibrio vulnificus)، در مطالعات فراوانی به عنوان عوامل اصلی ایجادکننده عفونت‌های دستگاه گوارشی و گاستروآنتریت حاد (Acute gastroenteritis) در اثر مصرف فرآورده‌های دریایی خام، گزارش شده‌اند (Yutaka et al., 2006; Jawotz et al., 2002). بررسی‌ها نشان داده‌اند که حضور فاکتورهای حدتی مانند همولیزین مستقیم مقاوم به حرارت (Thermostable Direct Hemolysin (tdh))، همولیزین وابسته به فاکتور tdh (Thermostable Direct Hemolysin-related Hemolysin (trh)) و همولیزین حساس به حرارت (Thermolabile Hemolysin (tlh)) در ویبریو پاراهمولیتیکوسهای جدا شده از غذاهای دریایی، عامل اصلی بروز گاستروآنتریت و عفونت‌های گوارشی بوده است (Dileeo et al., 2003; Wong and Chen, 1999; Guerry and Colwell, 1977).

   بنابراین با توجه به اهمیت بالای تغذیه‌ای میگو و فرآورده‌های آن و همچنین افزایش روز افزون مصرف این فرآورده‌ها در ایران، مطالعه حاضر به منظور تعیین کیفیت میکروبی میگوهای خام و نمک سود شده از نظر حضور گونه‌های ویبریو و همچنین فراوانی فاکتورهای حدت ویبریو پاراهمولیتیکوس، انجام گرفت.

 

 

 

مواد و روش‌ها

جمع‌آوری نمونه‌ها

   در کل 60 نمونه میگو شامل میگوهای تازه صید شده از خلیج فارس و میگوهای نمک سود شده، در تابستان سال 1392 از منطقه گناوه، به صورت کاملاً تصادفی، جمع‌آوری شدند. تمام میگوهای مورد بررسی از نوع پنئوس سمی سولکاتوس (Penaeus semisulcatus) که گونه معمول خلیج فارس است، بودند. نمونه‌ها با فواصل بین 10-7 روز جمع‌آوری و در مجاورت یخ (4 درجه سلسیوس) و در اسرع وقت به مرکز تحقیقات تخصصی مواد غذایی دانشگاه آزاد اسلامی شهرکرد منتقل شدند.

اندازه‌گیری درصد نمک میگوی نمک سود شده

   اندازه‌گیری درصد نمک میگوهای نمک سود شده توسط روش استاندارد ایران به شماره ی 1-741 انجام پذیرفت.

جداسازی ویبریو

   تمام نمونه‌ها بلافاصله پس از ارسال به آزمایشگاه و آماده‌سازی، مورد آزمایش میکروبی قرار گرفتند. به این منظور در شرایط آسپتیک با کمک اسکالپل سترون، 25 گرم از گوشت ناحیه شکمی نمونه‌های میگو جداسازی و پس از هموژنیزاسیون در 225 میلی‌لیتر محلول آب پپتونه قلیایی (مرک، آلمان) حاوی 3 درصد نمک (3/8pH= )، برای 24 ساعت در 37 درجه سلسیوس گرم‌خانه‌گذاری شدند. در ادامه یک لوپ از محلول گرم‌خانه‌گذاری شده به شکل سطحی روی محیط تیوسولفات-سیترات- بایل سوکروز آگار (TCBSA) (مرک، آلمان) کشت و برای 24 ساعت در 37 درجه سلسیوس گرم‌خانه‌گذاری شدند.

   پس از طی شدن دوره گرم‌خانه‌گذاری، پرگنه‌های رشدیافته در محیط TCBSA از نظر پرگنه‌های ویبریو مورد بررسی قرار گرفتند. پرگنه‌های ویبریو در سطح این محیط به رنگ زرد- خاکستری با تلألو آبی رنگ، نمایان می‌شوند. ویبریو پاراهمولیتیکوس به صورت کلونی‌های سبز یا آبی با ضخامت 3-2 میلی‌متر ظاهر می‌شود. سپس پرگنه‌های‌های سبز-آبی ویبریو پاراهمولیتیکوس توسط تست‌های بیوشیمیایی مورد ارزیابی قرار گرفتند. به این منظور 3-1 کلونی رشدیافته بر محیط اختصاصی ویبریو پاراهمولیتیکوس جهت خالص‌سازی روی محیط آگار مغذی به آب گوشت قلب و مغز منتقل شد و برای 6-4 ساعت در 37 درجه سلسیوس گرم‌خانه‌گذاری شد تا کدورتی بیشتر یا برابر 5/0= OD در 620 نانومتر به دست آید. سپس نمونه‌ها با استفاده از روش‌های بیوشیمیایی از جمله تست سیترات، مقاومت به نمک، اوره آز، تست VP، تخمیر قندهای سلوبیوز، سالیسین، گلوکز، ساکارز، آرابینوز، مانیتول، اورنیتین، آرژینین و تست ONPG، مورد بررسی قرار گرفتند.

استخراج DNAو واکنش‌های PCR

   DNA ژنومی با استفاده از کیت استخراج DNA شرکت سیناژن ایران و با توجه به دستورالعمل شرکت سازنده، از پر گنه‌های تیپیک رشد کرده، استخراج شد. تمامی نمونه‌های DNA تا زمان انجام PCR، در فریزر20-  نگه‌داری شدند.

   توالی پرایمرهای مورد استفاده برای جداسازی گونه‌های ویبریو در جدول 1 نشان داده شده‌اند (Tarr et al., 2007).

 

 

 

جدول 1- توالی پرایمرهای مورد استفاده برای شناسایی گونه‌های ویبریو در میگو و فرآورده‌های آن

اندازه محصول (bp)

 (5’-3’) توالی پرایمر

نام پرایمر

نام باکتری

248

AAGACCTCAACTGGCGGTA

GAAGTGTTAGTGATCGCCAGAGT

Vc.sodB-F

Vc.sodB-R

ویبریو کلرا

382

GAAG CAGCACTCACCGAT GGTGAAGACTCATCAGCA

Vm.sodB-F

Vm.sodB-R2

ویبریو هاروی

897

GCAGCTGATCAAAACGTTGAGT

ATTATCGATCGTGCCACTCAC

Vp.flaE-79F

Vp.flaE-934R

ویبریو

پارا همولیتیکوس

410

GTCTTAAAGCGGTTGCTGC

CGCTTCAAGTGCTGGTAGAAG

Vv.hsp-326F

Vv.hsp-697R

ویبریو ولنیفیکوس

                   

    

  

 

   به منظور انجام تمام واکنش‌های زنجیره‌ای پلیمراز از دستگاه Master Cycler Gradiant (Eppendorf, Germany) در قالب برنامه‌های Multiplex PCR استفاده شد. واکنش زنجیره‌ای پلیمراز جهت ردیابی گونه‌های باکتری ویبریو در حجم نهایی 50 میکرولیتر شامل 5 میکرولیتر بافر X 10، 5/1 میلی‌مول MgCl2250 میکرومول دیوکسی نوکلئوتید تری فسفات ، 200 میکرومول dNTP، 1میکرومول از زوج پرایمرهای جلویی و عقبی، 5 میکرولیتر از هر نمونه DNA  و 25/1 واحد آنزیم DNA Taq Polymerase، انجام پذیرفت. برنامه حرارتی مورد استفاده به منظور تکثیر گونه‌های باکتریایی مورد نظر شامل: 15 دقیقه 93 درجه سلسیوس، 40 ثانیه 92 درجه سلسیوس، 1 دقیقه  57 درجه سلسیوس، 5/1 دقیقه 72 درجه سلسیوس (35 سیکل دمایی) و یک مرحله نهایی 7 دقیقه 72 درجه سلسیوس، می‌باشد.

   تمام نمونه‌هایی که از نظر باکتری ویبریو پارا همولیتیکوس مثبت شدند، با استفاده از یک برنامه PCR چندتایی دیگر برای حضور ژن‌های حدت tdh، tlh و trh، مورد بررسی قرار گرفتند. توالی پرایمرهای مورد استفاده جهت ردیابی ژن‌های حدت ویبریو پاراهمولیتیکوس در جدول 2 آورده شده است (Ward and Bej, 2006).

 

 

جدول 2- توالی پرایمرهای مورد استفاده برای شناسایی ژن‌های حدت ویبریو پاراهمولیتیکوس جدا شده از میگو و فرآورده‌های آن

اندازه محصول

(5’-3’) توالی پرایمر

نام ژن

229

GTARAGGTCTCTGACTTTTGGAC

CTACAGAATYATAGGAATGTTGAAG

tdh

207

CCATCMATACCTTTTCCTTCTCC

ACYGTCATATAGGCGCTTAAC

trh

450

AAAGCGGATTATGCAGAAGCACTG

GCTACTTTCTAGCATTTTCTCTGC

tlh

 

  واکنش زنجیره‌ای پلیمراز جهت ردیابی ژن‌های حدت ویبریو پاراهمولیتیکوس در حجم نهایی 50 میکرولیتر شامل 5 میکرولیترX  10 بافرPCR ، 5/1 میلی‌مول Mgcl2250 میکرومول دیوکسی نوکلئوتید تری فسفات ، 200 میکرو مول dNTP، 1میکرومول از زوج پرایمرهای جلویی و عقبی، 5 میکرولیتر از هر نمونه DNA  و 25/1 واحد آنزیم DNA Taq Polymerase، انجام پذیرفت. برنامه حرارتی مورد استفاده به منظور تکثیر ژن‌های مورد نظر شامل: 120 ثانیه 95 درجه سلسیوس، 20 ثانیه 95 درجه سلسیوس، 20 ثانیه 56 درجه سلسیوس، 30 ثانیه 72 درجه سلسیوس (45 سیکل دمایی) و یک مرحله نهایی 10 دقیقه C º 72، می‌باشد.

 

الکتروفورز محصولات PCR

   در نهایت محصولات PCR با استفاده از ژل آگارز 5/1 درصد رنگ‌آمیزی‌شده با اتیدیوم بروماید، الکتروفورز شدند. برای این منظور، 15 میکرولیتر از محصول  PCRرا با 3 میکرولیتر رنگ نشانگرLoading buffer  مخلوط و به داخل چاهک ژل منتقل گردید. الکتروفورز نمونه‌ها در ولتاژ ثابت 90 ولت به مدت 20 دقیقه انجام گرفت و در نهایت محصول الکتروفورز توسط دستگاه قرائت‌کننده ژل مورد بررسی قرار گرفت.

 

 

 

تجزیه و تحلیل آماری داده‌ها

   داده‌های حاصل از این مطالعه با استفاده از نرم افزار SPSS شماره 16، تجزیه و تحلیل گردید و با استفاده از آزمون مربع کای اختلافات آماری بین حضور گونه‌های ویبریو و فراوانی انواع فاکتورهای حدت در بین سوش‌های ویبریو پاراهمولیتیکوس با ضریب اطمینان 95 درصد در دو محصول میگو تازه و نمک سود شده مورد بررسی قرار گرفتند.

 

یافته‌ها

   بر اساس نتایج به دست‌آمده درصد نمک میگوی نمک سود شده با استفاده از روش استاندارد معادل  6/7 درصد بدست آمد. نتایج بررسی حاضر نشان می‌دهد که از کل 60 نمونه میگو مورد بررسی، گونه‌های ویبریو در 13 نمونه (66/21 درصد)، حضور داشتند (جدول 3). در کل 20 درصد از نمونه‌های میگو تازه و 33/23 درصد از نمونه‌های میگو نمک سود شده از نظر حضور گونه‌های ویبریو مثبت بودند. فراوان‌ترین گونه جداسازی شده ویبریو ولنیفیکوس (33/8 درصد) بوده است در حالی‌که ویبریو کلراکمترین فراوانی را داشته است (66/1درصد). بررسی‌های آماری هیچ‌گونه اختلاف معنی‌دار آماری را برای میزان شیوع گونه‌های مختلف ویبریو و همچنین برای میزان شیوع گونه‌های ویبریو در نمونه‌های مختلف، نشان ندادند.

 

 

 

 

جدول3-  فراوانی آلودگی میگوهای تازه و نمک سود شده به گونه‌های ویبریو

 

میگو
 (تعداد نمئنه)

 

نمونه های آلوده به گونه های ویبریو (%)

 

فراوانی گونه های ویبریو جداسازی شده (%)

ویبریو

کلرا

ویبریو

ولنیفیکوس

ویبریو

پاراهمولیتیکوس

ویبریو

هاروی

تازه (30)

6

(20)

1

(33/3)

1

(33/3)

2

(66/6)

2

(66/6)

نمک سود (30)

7

(33/23)

-

4

(33/13)

2

(66/6)

1

(33/3)

کل (60)

13

(66/21)

1

(66/1)

5

(33/8)

4

(66/6)

3

(5)

               

 

 

  

 

میزان شیوع ژن‌های حدت ویبریو پاراهمولیتیکوسهای جداسازی شده از میگوهای تازه و نمک سود شده در جدول 4 آورده شده است. نتایج نشان می‌دهند که ژن‌های حدت tlh، tdh و trh به ترتیب در 100درصد، 50 درصد و 25 درصد از نمونه‌های میگو آلوده به ویبریو پاراهمولیتیکوس، ردیابی شدند. اختلاف آماری در حد (05/0p<) بین میزان حضور ژن tlh و ژن trh در نمونه‌های میگو بررسی شده و همچنین (05/0p<) برای فراوانی ژن‌های حدت بررسی‌شده بین نمونه‌های میگو تازه و منجمد شده، مشاهده شد.

 

 

جدول 4.  فراوانی ژن های حدت ویبریو پاراهمولیتیکوس جدا شده از میگو های تازه و نمک سود شده

 

میگو

آلوده به ویبریو پاراهمولیتیکوس

فراوانی ژن‌های حدت (%)

tlh

tdh

trh

تازه

 

2

2

(100%)

2

(100 %)

1

( 100%)

نمک سودشده

2

2

(100%)

0

0

کل

4

4

(  100%)

2

(50 %)

1

(25%)

 


بحث و نتیجه‌گیری

   در مطالعه حاضر گونه‌های ویبریو پاراهمولیتیکوس، ویبریو کلرا، ویبریو ولنیفیکوس و ویبریو هاروی از نمونه‌های میگو تازه و نمک سود شده، جداسازی شدند که از نظر بهداشت عمومی بسیار قابل توجه است. میزان شیوع گونه‌های ویبریو در این بررسی 66/21درصد بدست آمد که بسیار قابل توجه است. همچنین نتایج این بررسی نشان داد که میزان شیوع گونه‌های ویبریو کلرا، ویبریو ولنیفیکوس، ویبریو پاراهمولیتیکوس و ویبریو هاروی به ترتیب 66/1درصد، 33/8درصد، 66/6درصد و 5 درصد بوده است. مطالعات مشابه دیگری نیز در جهان انجام پذیرفته است. ونگ و همکاران در مطالعه مشابه در خصوص بررسی وقوع گونه‌های ویبریو در میگوهای صیدشده در تایلند نشان دادند که 8/73 درصد از میگوهای صیدشده آلوده به ویبریو پاراهمولیتیکوس بودند که در مقایسه با نتایج این بررسی، میزان شیوع بسیار بیشتری را نشان می‌دهد (Wong and Chen, 1999). راگوناس و همکاران در سال 2008، مطالعه‌ای بر روی غذاهای دریایی جزایر جنوب غربی هندوستان انجام دادند که میزان آلودگی به ویبریو پاراهمولیتیکوس را معادل 75 درصد گزارش کردند (Raghunath et al., 2008). همچنین نتایج بررسی کولاکوگلو و همکاران نشان می‌دهد که از 30 نمونه میگو بررسی شده که از سواحل ترکیه صید شده بودند، 14 نمونه (7/46 درصد) آلوده به گونه­های ویبریو آلژینولیتیکوس، ویبریو ولنیفیکوس و ویبریو پاراهمولیتیکوس بوده‌اند که از نتایج این بررسی بیشتر بوده است (Colakoglu et al., 2006).بررسی‌های مشابه دیگری نیز در ایران انجام پذیرفته است. رحیمی و همکاران (Rahimi et al., 2010) میزان شیوع گونه‌های ویبریو در میگو را 7/26درصد، غلامپور در سال 1388 میزان شیوع را 4/20 درصد در میگو و لابستر، حسینی و همکاران (Hosseini et al., 2004) این میزان را 1/2 درصد در میگو، رئیسی و همکاران (Raissy et al., 2012) میزان شیوع را 5 درصد در صدف، شیرازی و همکاران (Shirazi et al., 2007) 10-5 درصد در ماهی قزل آلای رنگین‌کمان و ماهی سفید و در نهایت جلالی جعفری و برزگر دولت آبادی (Jalali Jafari and Barzegar Dolatabadi, 2008) 9/3 درصد در اغذیه دریایی استان اصفهان، گزارش کردند. دلیل اصلی میزان‌های شیوع متفاوتی که برای باکتری‌های گونه ویبریو از نقاط مختلف جهان گزارش شده است را می‌توان به نوع نمونه (میگو، ماهی، صدف)، روش پرورش نمونه (پرورشی یا آزاد بودن)، روش فرآوری نمونه (تازه، نمک سود شده)، گونه ویبریو مورد مطالعه، روش نمونه‌گیری، تعداد نمونه‌ها، روش انجام آزمایش، منطقه جغرافیایی مورد مطالعه، فصل، درصد شوری آبی که نمونه‌ها در آن پرورش یافته‌اند و حتی گرم آبی و سرد آبی بودن نمونه، می‌باشد.

   ویبریو پاراهمولیتیکوس اصلی‌ترین پاتوژن غذا زاد در منطقه آسیا خصوصاً آسیای شرقی محسوب می‌شود (Javoz et al., 2002). در کل میزان شیوع گاستروآنتریت ناشی از این گونه ویبریو 4/49 درصد برآورد شده است (Jatapai et al., 2010). بر اساس تخمین مرکز کنترل بیماری‌ها (Center for Diseases Control (CDC))، سالانه 50 مورد مسمومیت غذایی شدید ناشی از مصرف غذاهای آلوده به ویبریو پاراهمولیتیکوس در آمریکا روی می­دهد که نیاز به بستری شدن در بیمارستان دارند اما در عمل سالانه 41 هزار نفر مبتلا به عفونت‌های روده‌ای ناشی از این باکتری، هستند (Newton et al., 2011; CDC 2009; CDC 2011).

   دلیل اصلی بالا بودن میزان شیوع گونه‌های ویبریو در نمونه‌های میگو نمک سود شده احتمالاً کافی نبودن میزان نمک در این نمونه‌ها بوده است. گونه‌های ویبریو به راحتی غلظت نمک 8 درصد را هم تحمل می‌کنند. این در حالی است که میزان نمک میگوهای مورد بررسی در مطالعه ما 6/7 درصد بدست آمد. بنابراین به نظر می‌رسد که فرآیند نمک سود کردن به درستی انجام نپذیرفته است. یانگ و همکاران نیز در سال 2008 نشان دادند که میگوهای نمک سود شده از بار آلودگی تقریباً زیادی به گونه‌های ویبریو برخوردار هستند (Yang et al., 2008). احتمالا آب مصرفی به منظور شست و شوی نمونه‌های میگوی تازه نیز آلوده به باکتری‌های گونه ویبریو بوده است. هر چند در مورد آلودگی نمونه‌های میگوی مورد بررسی در مطالعه حاضر، آلودگی‌های متقاطعی مانند عدم رعایت بهداشت فردی در کارکنان مراکز صید، عمل‌آوری و توزیع میگو، را نباید نادیده گرفت.

   بررسی حاضر نشان داد که هر 3 ژن مورد مطالعه و خصوصا ژن‌های حدت tlh و tdh از فراوانی بالایی در نمونه‌های میگو مورد بررسی برخوردار هستند. نتایج مشابه توسط یانگ و همکاران  (Yang et al., 2008) و محمود و همکاران (Mahmud et al., 2006)، گزارش شده است. اوتاویانی و سانتارلی در سال 2005 مطالعه‌ای را بر روی غذاهای دریایی صید شده از دریای آدریاتیک، انجام دادند. نتایج بررسی آن‌ها نشان می‌دهد که از 144 گونه ویبریو پاراهمولیتیکوس، 35 سویه (30/24درصد) ویبریو پاراهمولیتیکوس پروتئاز مثبت بودند. آن‌ها وجود ژن‌هایtdh و trh را در این نمونه‌ها ثابت کردند و نشان دادند که این ژن‌ها باعث همولیز شدن گلبول قرمز شده و سیستم ایمنی را تضعیف می‌کند. بنا بر نتایج این بررسی مصرف غذاهای دریایی آلوده به ویبریو پاراهمولیتیکوس بدلیل حدت بالای این گونه باکتری، سبب بروز اختلالات گوارشی شدیدتری خواهد شد (Ottaviani and Santarelli, 2005). بنابراین حضور این ژن‌های حدت در باکتری ویبریو پاراهمولیتیکوس نقش به سزایی در بیماری‌زایی باکتری دارد.

   نتایج بررسی حاضر نشان‌دهنده شیوع بالای گونه‌های ویبریو و خصوصا ویبریو پاراهمولیتیکوس در نمونه‌های میگو تازه و نمک سود شده می‌باشد. حضور فاکتورهای حدت tdh، trh و tlh در جدایه‌های ویبریو پاراهمولیتیکوس نشان‌دهنده توانایی بالای این گونه در بروز بیماری می‌باشد. بنابراین مصرف میگو به صورت خام یا نیم پز می‌تواند سبب بروز مسمومیت‌های غذایی جدی در اثر باکتری‌های گونه ویبریو شود. از طرفی جداسازی باکتری‌های گونه ویبریو از میگوهای نمک سود شده می‌تواند نشان‌دهنده نقص در عمل نمک سود کردن یا بروز آلودگی‌های متقاطع باشد. نتایج می‌توانند تاییدکننده عدم رعایت بهداشت در مراکز تهیه و توزیع میگو و فرآورده‌های آن در شهرستان گناوه باشند. پیشنهاد می‌شود که از روش PCR تستی ایمن، دقیق و سریع برای تشخیص گونه‌های ویبریو در فرآورده‌های دریایی است، به منظور کنترل بهداشت فرآورده‌های دریایی از نظر حضور گونه‌های ویبریو، استفاده شود.

  • ·   جاوتز، ارنست؛ فرددریک، جورج و استفان، مورس (1381). میکروب‌شناسی پزشکی جاوتز، ترجمه: ارجمند، محسن و  ستوده نیا، عبدالحسین،  انتشارات نسل فردا، تهران، صفحات: 358-356.
  • جلالی جعفری، بهیار و برزگر دولت آبادی، مریم (1387). مدیریت بهداشتی پرورش میگو، تهران: انتشارات نور بخش، صفحات: 24-12.
  • رهبر، محمد؛ صبوریان، رقیه؛ صارمی، مهناز؛ عباسی، محمد؛ معصومی اصل، حسن و سروش، محمود (1386). بررسی جنبه‌های همه‌گیرشناسی و مقاومت آنتی‌بیوتیکی ویبریو کلرا، بیو تایپ التور سروتایپ اینابا در همه‌گیری تابستان سال 1384 در ایران.مجله علمی پژوهشی دانشگاه علوم پزشکی اردبیل: دوره هفتم، شماره اول، بهار، صفحات: 41 – 45.
  • شیشه چیان، فرشاد (1382). لابستر، مؤسسه هماهنگی تعاونی‌های صیادی، دفتر پژوهش‌های اجتماعی و اقتصادی، صفحات: 23-4.
  • غلامپور، احمدرضا (1388). بررسی وقوع و خصوصیات ملکولی ویبریوپاراهمولیتیکوس جدا شده در میگو و لابسترهای صید شده از سواحل خلیج فارس. پایان‌نامه دکتری دامپزشکی دانشگاه آزاد شهرکرد، شماره 619، صفحات: 21-77.
  • فریزر، ویلیلام و ووستاف، دنیس (1378). میکروب‌شناسی مواد غذایی، ترجمه: حاجیه قاسیان صفایی، ح.، چاپ اول، انتشارات علوم پزشکی اصفهان صفحات: 515-87.
  • گرووز، روی (1380). زیست‌شناسی و پرورش شاه‌میگو آب شیرین، ترجمه: حامد ناظرانی هوشمند، تهران: انتشارات راه دانایی، صفحات: 33-19.

 

  • Centers for Disease Control and Prevention. (2009). Surveillance for foodborne disease outbreaks—United States, 2006. Morbidity and Mortality Weekly Report, 58 (22): 609–15.
  • Centers for Disease Control and Prevention. (2011). Center for Disease Control and Prevention Outbreak Response Team.; http://www.cdc.gov/outbreaknet/. Accessed
  • Colakoglu, F.A., Sarmasik, A. and Koseoglu, B. (2006). Occurrence of Vibrio spp. and Aeromonas spp. in shellfish harvested off Dardanelles cost of Turkey. Food Control, 17(8): 648-652.
  • Dileep, V., Kumar, H.S., Kumar, Y., Nishibuchi, M., Karunasagar, I. and Karunasagar, I. (2003). Application of polymerase chain reaction for detection of Vibrio parahaemolyticus associated with tropical seafoods and coastal environment. Letters in Applied Microbiology,36(6): 423-427.
  • Guerry, P. and Colwell, R.R. (1977). Isolation of cryptic plasmid deoxyribonucleic acid from Kanagawa positive strains of Vibrio parahaemolyticus. Infection and Immunity,16(1): 328-334.
  • Hill, W.E. (1996). The polymerase chain reaction: applications for the detection of foodborne pathogens. Critical Review in Food Science Nutration, 36(1-2): 123-173.
  • Hosseini, H., Cheraghali, A.M., Yalfani, R. and Razavilar, V. (2004). Incidence of Vibrio spp. in shrimp caught off south coast of Iran. Food Control,15(3): 187- 190.
  • Jatapai. A., Moungthong, B., Thunyaharn, S., Huttayananont, S. and Rangsin, R. (2010). An acute gastroenteritis outbreak of Vibrio parahaemolyticus O4:K55 in Nursing College, Thailand. Tropical Biomedicine, 27(2): 265-74.
  • Kaysner, C.A. and DePaola, A. (2001). Vibrio. In: Compendium of Methods of the Microbiological Examination of Foods, 4th edition. Downes FP and Ito K (eds.). Washington, DC: American Public Health Association, pp. 405–420.
  • Newton, A., Kendall, M., Vugia, D.J., Henao, O.L. and Mahon, B.E. (2010). Increasing Rates of Vibriosis in the United States, 1996–2010: Review of Surveillance Data from 2 Systems. Clinical Infectious Diseases, 5(54): S391-S395.
  •  Ottaviani, D., Santarelli, S., Bacchiocchi, S., Masini, L., Ghittino, C. and Bacchiocchi, I. (2005). Presence of pathogenic Vibrio parahaemolyticus strains in mussels from the Adriatic Sea, Italy. Food Microbiology, 22(6): 585-590.
  • Raghunath, P., Acharya, S., Bhanumathi, A., Karunasagar, I. and Karunasagar, I. (2008). Detection and molecular  characterization of  Vibrio arahaemolyticus  isolated  from  seafood  harvested  along  the  southwest  coast  of  India. Food Microbiology, 25(6): 824-830.
  • Rahimi, E., Ameri, M., Doosti, A. and Gholampour, A.R. (2010). Occurrence of toxigenic Vibrio parahaemolyticus strain in shrimp in Iran. Food borne Pathogens and Disease, 7(9): 1107-1111.
  • Raissy, M., Moumeni, M., Ansari, M. and Rahimi, E. (2012). Antibiotic resistance pattern of some Vibrio strains isolated from seafood, Iranian Journal of Fisheries Science, 11(3): 618-626.
  • Razavilar, V. (1996). The control strategy of enteric foodborne illnesses caused by animal source, using predictive food microbiology and LISA system. In: Proc, The 3rd National Congress of Zoonoses in Iran, Mashhad, pp. 7-15.
  • Razavilar, V. (1998). Bahavior of Vibrio in a soft fresh type cheese without lactic starter affected by serotype, temperature and storage time. Journal of the Faculty of Veterinary University of Tehran, Iran, 52(2): 135-137.
  • Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.A., Roy, S.L., et al. (2011). Foodborne illness acquired in the United States—major pathogens. Emerging Infection Diseases, 17(1): 7–15.
  • Shirazi, M.H., Ranjbar, R, Salari, M.H., Bagheri Tirtash, Y., Najafi, A. and Sadeghifard, N. (2007).  Isolation of Vibrio parahaemolyticus from fish in Tehran and their antimicrobial resistance. Iranian Journal of Infection Diseases and Tropical Medicine, 11(35): 65-68.
  • Su, Y. and Liu, C. (2007). Vibrio parahaemolyticus: A concern of sea food safety. Food Microbiology, 24(6): 549- 558.
  • Tarr, C.L., Patel, J.S., Puhr. N.D., Sowers, E.G., Bopp, C.A. and Strockbine, N.A. (2007). Identification of Vibrio Isolates by a Multiplex PCR Assay andrpoB Sequence Determination. Journal of Clinical Microbiology, 45(1): 134-140.
  • Ward, L. and Bej, A. (2006). Detection of Vibrio parahaemolyticus in Shellfish by Use of Multiplexed Real-time PCR with TaqMan Fluorescent Probes. Applied and Environmental Microbiology, 72(3): 2031-2042.
  • Wong, H.C., Chen, M.C., Liu, S.H. and Liu, D.P. (1999). Incidence of highly genetically diversified Vibrio parahaemolyticus in seafood imported from Asian countries. InternationalJournal of Food Microbiology, 52(3): 181-188.
  • Yang, Z.Q., Jiao, X.A., Zhou, X.H., Cao, G.X., Fang, W.M. and Gu, R.X. (2008). Isolation and molecular characterization of Vibrio parahaemolyticus from fresh, low-temperature preserved, dried, and salted seafood products in two coastal areas of eastern China.  International Journal of Food Microbiology, 125(3): 279-285.
  • Yutaka, Y., Satomi, M. and Oikawa, H. (2006). Antimicrobial effect of spices and herbs on Vibrio parahaemolyticus. Journal of Food Microbiology, 111(1): 6–1.